SubtiBank SubtiBank
yaaH
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yaaH

general stress protein, survival of ethanol stress, [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA]-dependent protein of the inner spore coat, spore cortex lytic protein
locus
BSU_00160
pI
5.62
mw
48.47 kDa
protein length
427 aa Sequence Blast
gene length
1284 bp Sequence Blast
function
survival of ethanol stress, protection of the spore
product
N-acetylglucosaminidase
essential
no
synonyms
sleL

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.1|Class I]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    23,868 25,151

    The protein

    Protein family

  • [SW|Glycosyl hydrolase 18 family] (according to UniProt)
  • Chitinase class II subfamily (with [protein|DFA0BFED9FC2C47ABAA2284514CE2F81BD9EDFEF|YdhD], according to UniProt)
  • Paralogous protein(s)

  • [protein|DFA0BFED9FC2C47ABAA2284514CE2F81BD9EDFEF|YdhD]
  • [SW|Domains]

  • contains two N-acetylglucosamine-polymer-binding [SW|LysM domain]s at the N-terminus (aa 2-46, aa 51-95) [Pubmed|18430080]
  • [SW|glycoside hydrolase family 18 domain] (aa 125 to 410)
  • [SW|LysM domain] 1 (aa 2-46) (according to UniProt)
  • [SW|LysM domain] 2 (aa 51-95) (according to UniProt)
  • Structure

  • [PDB|4S3K] (SleL from B. megaterium, 55% identity) [pubmed|26190134]
  • [SW|Localization]

  • inner spore coat, localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [Pubmed|19933362,22171814]
  • Additional information

  • required for survival of ethanol stress [Pubmed|15805528]
  • Expression and Regulation

    Operons

    genes
    [gene|77BEC74867422AA225A1F12AD63464656DBDCBE8|yaaH]
    description
    [Pubmed|10419957]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,10419957], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|15383836,10419957]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    genes
    [gene|95C78F511C49E04241D31593E6837BDFF48D6E14|yaaI]-[gene|77BEC74867422AA225A1F12AD63464656DBDCBE8|yaaH]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B889 (yaaH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1888 NBRP B. subtilis, Japan]
  • BKE00160 ([gene|77BEC74867422AA225A1F12AD63464656DBDCBE8|yaaH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATAAATTTGAATGAAAA, downstream forward: _UP4_TAATTTGGAAACGTCTTTTT
  • BKK00160 ([gene|77BEC74867422AA225A1F12AD63464656DBDCBE8|yaaH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATAAATTTGAATGAAAA, downstream forward: _UP4_TAATTTGGAAACGTCTTTTT
  • References

    Reviews

  • 18430080,23202530
  • Original publications

  • 19087206,12884008,10419957,15805528,11964120,19933362,22171814,15383836,22343356,18835992,26190134,30455281