SubtiBank SubtiBank
swsB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

swsB

similar to deacetylase, required for efficient degradation of the spore cortex by [protein|49ED84B48CEC09493B6056D03D2A57578770CE15|CwlJ] during [SW|germination]
locus
BSU_16700
pI
9.36
mw
36.31 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast
function
required for spore cortex degradation during [SW|germination]
product
unknown
essential
no
synonyms
ylxY,ymxI

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,741,618 1,742,577

    The protein

    Protein family

  • [SW|polysaccharide deacetylase family] (according to UniProt)
  • [SW|Domains]

  • [SW|NodB homology domain] (aa 130-306) (according to UniProt)
  • Structure

  • [PDB|1W17] ([protein|88E167795BBCB8529E322E3A4DC9965EA6AAA617|PdaA], corresponds to aa 120 ... 317, 31% identity) [pubmed|15251431]
  • Biological materials

    Mutant

  • BKE16700 ([gene|77C3C4ADCBD38EEA99C44850CAEB310C59B6C938|swsB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTGTCCCCCCCTCA, downstream forward: _UP4_TAACAGATGAAGGCAGCTTG
  • BKK16700 ([gene|77C3C4ADCBD38EEA99C44850CAEB310C59B6C938|swsB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTGTCCCCCCCTCA, downstream forward: _UP4_TAACAGATGAAGGCAGCTTG
  • References

  • 23123912,15251431,31871031