SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


[SW|ABC transporter] (permease), export of the spore killing factor
51.72 kDa
protein length
448 aa Sequence Blast
gene length
1344 bp Sequence Blast
export of the spore killing factor [protein|DDB0022F50999AC52809D651C9CC5A5FDC71302C|SkfA]
[SW|ABC transporter] (permease)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Exporters] → [category|SW|Export of peptides]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    217,697 → 219,040

    Phenotypes of a mutant

  • inactivation of ''[gene|77D93CAEF46EBBB9BAF570714445E194D5F2884E|skfF]'' reduces sporulation efficiency to 62.3% that of wild type cells [Pubmed|26735940]
  • The protein


  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16452424], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [PubMed|14651647,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|15687200,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|16816204], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [,15687200 PubMed]
  • additional information

  • Northern blotting during during phosphate limitation showed an intense 0.25 kb '[protein|DDB0022F50999AC52809D651C9CC5A5FDC71302C|SkfA]'-specific transcript, and a weaker 6.5 kb [gene|DDB0022F50999AC52809D651C9CC5A5FDC71302C|skfA]-[gene|F981C605C652D1A4429579A5F24608CE7F570834|skfB]-[gene|4DFF9924E07D834F37580D73E88451C1671C5111|skfC]-[gene|5886364199844356446C08F08664B301A714E74A|skfE]-[gene|77D93CAEF46EBBB9BAF570714445E194D5F2884E|skfF]-[gene|527AB8EAAF0A1AAD4E5B714B35ED9F78BECC17EC|skfG]-[gene|F31B12F80AFC3580FD33811A1C22E74F75DC1A85|skfH] transcript
  • view in new tab

    Biological materials


  • MGNA-C516 (ybdB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE01960 (Δ[gene|77D93CAEF46EBBB9BAF570714445E194D5F2884E|skfF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTTTTCCTGACCTT, downstream forward: _UP4_TAGTGGTTATGTAGAGTTAT
  • BKK01960 (Δ[gene|77D93CAEF46EBBB9BAF570714445E194D5F2884E|skfF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTTTTCCTGACCTT, downstream forward: _UP4_TAGTGGTTATGTAGAGTTAT
  • References


  • 20955377
  • Original Publications

  • 10092453,12817086,16816204,14651647,15687200,15687200,17720793,11731129,17449691,18840696,26735940