SubtiBank SubtiBank
gidA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gidA

glucose-inhibited division protein, tRNA uridine 5-carboxymethylaminomethyl modification enzyme
locus
BSU_41010
pI
6.33
mw
69.58 kDa
protein length
628 aa Sequence Blast
gene length
1887 bp Sequence Blast
function
tRNA modification
product
tRNA uridine 5-carboxymethylaminomethyl modification enzyme
essential
no
synonyms
mnmG

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    4,209,603 4,211,489

    Phenotypes of a mutant

  • inactivation of ''[gene|7809B4F5B9172EBB6C91BDE7B673FB08E82763FF|gidA]'' reduces sporulation efficiency to 23.9% that of wild type cells; longer mother cells, with some aberrant septa and forespores [Pubmed|26735940]
  • The protein

    Protein family

  • MnmG family (with [protein|B6062575849EA65BB7B44A9723676885799E2759|TrmFO], according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|3G05] (the protein of ''E. coli'', 51% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|66A6EC4F6CB91EE741BB9D7646913FF3EE602BD7|thdF]-[gene|7809B4F5B9172EBB6C91BDE7B673FB08E82763FF|gidA]-[gene|CCB7EE1D049585979303148FBDE0D42549E648DE|gidB]-[gene|559DEDC9887B811EF80994526256ADC48BA51CE3|noc]
    description
    [Pubmed|11807071]

    regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|11948146], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [Pubmed|26020636], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]
  • regulation

  • constitutively expressed [Pubmed|23701187]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B876 (gidA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1875 NBRP B. subtilis, Japan]
  • BKE41010 ([gene|7809B4F5B9172EBB6C91BDE7B673FB08E82763FF|gidA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE41010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTCTAGTTCCTCCTT, downstream forward: _UP4_ATAGCCGAGTAGAAAGGATG
  • BKK41010 ([gene|7809B4F5B9172EBB6C91BDE7B673FB08E82763FF|gidA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK41010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTCTAGTTCCTCCTT, downstream forward: _UP4_ATAGCCGAGTAGAAAGGATG
  • References

    Reviews

  • 26832457
  • Original publications

  • 19801413,11807071,11948146,26020636,26735940,30249152