SubtiBank SubtiBank
yloB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yloB

ATP-driven Ca2+ pump, transports calcium ions from the mother cell to the forespore
locus
BSU_15650
pI
8.71
mw
97.10 kDa
protein length
890 aa Sequence Blast
gene length
2673 bp Sequence Blast
function
accumulation of calcium in the spore
product
ATP-driven Ca2+ pump
essential
no
ec
3.6.3.8
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW 1.3.1.4|Metal ion homeostasis/ Other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,637,965 1,640,637

    Phenotypes of a mutant

  • forms unstable spores [pubmed|30602489]
  • delayed spore germination [pubmed|30602489]
  • The protein

    Catalyzed reaction/ biological activity

  • transport of calcium ions from the mother cell to the forespore [pubmed|30602489]
  • there is no indication for an implication of [protein|7821A09DADC6EAF589A882F05CC34BE900E06F2A|YloB] in Mg2+ uptake (based on mutant phenotypes, failure to complement mutants defective in Mg2+ uptake) [Pubmed|24415722]
  • ATP + Ca2+ + H2O --> ADP + Ca2+ + H+ + phosphate (according to UniProt)
  • Protein family

  • [SW|cation transport ATPase (P-type) (TC 3.A.3) family] (according to UniProt)
  • Structure

  • [PDB|4YCM] (the calcium pump with bound marine macrolide BLS from O. cuniculus, 35% identity) [pubmed|25957767]
  • [SW|Localization]

  • cell membrane [pubmed|30602489]
  • Expression and Regulation

    Operons

    genes
    [gene|7821A09DADC6EAF589A882F05CC34BE900E06F2A|yloB]-[gene|A57D2C1536F3E93CD687C28C59FF297355CAB303|yloC]-[gene|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]-[gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk]-[gene|921933B6B893083F151AABDEDCBC65F2E55677BE|yloH]

    description

  • [pubmed|22383849]
  • regulation

  • expressed during sporulation in the mother cell [pubmed|12161109]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B139 (yloB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1138 NBRP B. subtilis, Japan]
  • BKE15650 ([gene|7821A09DADC6EAF589A882F05CC34BE900E06F2A|yloB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCGCTCGTCCACTCCC, downstream forward: _UP4_TAAATTCATATGATATAATC
  • BKK15650 ([gene|7821A09DADC6EAF589A882F05CC34BE900E06F2A|yloB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCGCTCGTCCACTCCC, downstream forward: _UP4_TAAATTCATATGATATAATC
  • References

  • 24415722,28951477,25957767,30602489