SubtiBank SubtiBank
comEA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

comEA

membrane DNA receptor, plays an important role in the transfer of transforming DNA into the DNA channel and in controlling the rate of DNA uptake
locus
BSU_25590
pI
4.82
mw
21.62 kDa
protein length
205 aa Sequence Blast
gene length
618 bp Sequence Blast
function
genetic competence
product
membrane DNA receptor
essential
no
synonyms
comD

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,640,513 2,641,130

    Phenotypes of a mutant

  • strongly reduced transformation rate [Pubmed|22398145]
  • The protein

    [SW|Domains]

  • extracellular DNA-binding domain
  • Structure

  • [PDB|2DUY] (from ''Thermus thermophilus hb8'', 37% identity, 60% similarity)
  • [SW|Localization]

  • cell membrane, no distinct position [Pubmed|21278288]
  • integral membrane protein [Pubmed|24164455]
  • Expression and Regulation

    Operons

    genes
    [gene|788725411B2E741103603373E43441FD036E1BA0|comEA]-[gene|954359717E15DFC106A9D8111C6637E46B16F8C9|comEB]-[gene|363C6FE07C5E56FDE6BEC6ACFBA1A5535F0F64AC|comEC]
    description
    [Pubmed|7968523,19028902]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7968523], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8196543], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • view in new tab

    Other regulations

  • [protein|F21A75744FA0B25D5A251CB57E7A7DC6ABFF1DC7|ComN]: post-translation control,
  • Biological materials

    Mutant

  • BKE25590 ([gene|788725411B2E741103603373E43441FD036E1BA0|comEA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTGCATGTTCCCCGCT, downstream forward: _UP4_TGATTTGACGGTCATGCATT
  • BKK25590 ([gene|788725411B2E741103603373E43441FD036E1BA0|comEA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTGCATGTTCCCCGCT, downstream forward: _UP4_TGATTTGACGGTCATGCATT
  • References

    Reviews

  • 15083159
  • Original publications

  • 9987128,11814663,7768800,16751195,7968523,17630974,21278288,19028902,21707789,22398145,24164455