SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


membrane DNA receptor, plays an important role in the transfer of transforming DNA into the DNA channel and in controlling the rate of DNA uptake
21.62 kDa
protein length
205 aa Sequence Blast
gene length
618 bp Sequence Blast
genetic competence
membrane DNA receptor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,640,513 2,641,130

    Phenotypes of a mutant

  • strongly reduced transformation rate [Pubmed|22398145]
  • The protein


  • extracellular DNA-binding domain
  • 2 HhH domains (aa 142-171,aa 172-302) (according to UniProt)
  • Structure

  • [PDB|2DUY] (from ''Thermus thermophilus hb8'', 37% identity, 60% similarity)
  • [SW|Localization]

  • cell membrane, no distinct position [Pubmed|21278288]
  • integral membrane protein [Pubmed|24164455]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7968523], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8196543], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • view in new tab

    Other regulations

  • [protein|F21A75744FA0B25D5A251CB57E7A7DC6ABFF1DC7|ComN]: post-translation control,
  • Biological materials


  • BKE25590 ([gene|788725411B2E741103603373E43441FD036E1BA0|comEA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTGCATGTTCCCCGCT, downstream forward: _UP4_TGATTTGACGGTCATGCATT
  • BKK25590 ([gene|788725411B2E741103603373E43441FD036E1BA0|comEA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTGCATGTTCCCCGCT, downstream forward: _UP4_TGATTTGACGGTCATGCATT
  • References


  • 15083159,31950915
  • Original publications

  • 9987128,11814663,7768800,16751195,7968523,17630974,21278288,19028902,21707789,22398145,24164455