SubtiBank SubtiBank
ytoA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ytoA

similar to ferripyochelin binding protein
locus
BSU_30520
pI
6.69
mw
18.64 kDa
protein length
171 aa Sequence Blast
gene length
516 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.4|Acquisition of iron/ based on similarity]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.2|Acquisition of iron/ based on similarity]
  • Gene

    Coordinates
    3,123,490 3,124,005

    The protein

    Protein family

  • [SW|Transferase hexapeptide repeat family] (according to UniProt)
  • Structure

  • [PDB|3VNP] (from Geobacillus kaustophilus, 77% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|78A2D4F19EEBBD05C38AF29651C1D4C3BF75F33A|ytoA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A127 (ytoA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/127 NBRP B. subtilis, Japan]
  • BKE30520 ([gene|78A2D4F19EEBBD05C38AF29651C1D4C3BF75F33A|ytoA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGATTCATCCTTCTTT, downstream forward: _UP4_TAAGACCTGCTTCGTCTTAC
  • BKK30520 ([gene|78A2D4F19EEBBD05C38AF29651C1D4C3BF75F33A|ytoA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGATTCATCCTTCTTT, downstream forward: _UP4_TAAGACCTGCTTCGTCTTAC
  • References

  • 20525796