SubtiBank SubtiBank
yxeE
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yxeE

spore coat protein
locus
BSU_39580
pI
8.48
mw
14.57 kDa
protein length
121 aa Sequence Blast
gene length
366 bp Sequence Blast
function
protection of the spore
product
spore coat protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.5|Class V]
  • Gene

    Coordinates
    4,065,597 4,065,962

    The protein

    [SW|Localization]

  • inner spore coat [Pubmed|19933362], localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [Pubmed|22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|7950EED7E3EE62BDFB96A1A54478CC89B175ABD3|yxeE]
    description
    [Pubmed|17905812]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,17905812], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|17905812], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|15699190,17905812]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B778 (yxeE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1777 NBRP B. subtilis, Japan]
  • BKE39580 ([gene|7950EED7E3EE62BDFB96A1A54478CC89B175ABD3|yxeE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGATCAGTCTCCTTGT, downstream forward: _UP4_TGAGCGAAACAAAGAAAAAA
  • BKK39580 ([gene|7950EED7E3EE62BDFB96A1A54478CC89B175ABD3|yxeE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGATCAGTCTCCTTGT, downstream forward: _UP4_TGAGCGAAACAAAGAAAAAA
  • References

  • 15699190,19933362,16479537,17905812,22171814