SubtiBank SubtiBank
nrgA
The papers of the month are back! Check them out! Link here

nrgA

ammonium transporter, required at low ammonium concentration
locus
BSU36510
pI
5.73
mw
42.57 kDa
protein length
404 aa Sequence Blast
gene length
1212 bp Sequence Blast
function
ammonium uptake
product
ammonium transporter
essential
no
synonyms
amtB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.8|Uptake of other small ions]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.1|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,756,790 → 3,758,004

    The protein

    Structure

  • [PDB|4NH2] (from ''E. coli'') [Pubmed|17220269]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot), membrane
  • Expression and Regulation

    Operons

    genes
    [gene|796BD46066B1E6147048664FA78679B42FA9D628|nrgA]-[gene|EC7C2A0B5A9A30B2FAA0CF9EEB9830CE0E6F2219|nrgB]
    description
    [Pubmed|8282685]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8282685], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|8799114], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • induced by ammonium limitation
  • view in new tab

    Biological materials

    Mutant

  • GP739 (cat), GP255 (''[gene|796BD46066B1E6147048664FA78679B42FA9D628|nrgA]-[gene|EC7C2A0B5A9A30B2FAA0CF9EEB9830CE0E6F2219|nrgB]'', cat), both available in [SW|Jörg Stülke]'s lab [Pubmed|14600241]
  • 1A920 ( ''nrgA''::''erm''), [Pubmed|8282685], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A920&Search=1A920 BGSC]
  • BKE36510 (Δ[gene|796BD46066B1E6147048664FA78679B42FA9D628|nrgA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCATTCCTCCGTAT, downstream forward: _UP4_GATTCTATGTGAGGAGTGAC
  • BKK36510 (Δ[gene|796BD46066B1E6147048664FA78679B42FA9D628|nrgA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCATTCCTCCGTAT, downstream forward: _UP4_GATTCTATGTGAGGAGTGAC
  • lacZ fusion

  • pGP168 (in [protein|search|pAC7]), available in [SW|Jörg Stülke]'s lab [Pubmed|14600241]
  • Labs working on this gene/protein

  • [SW|Susan Fisher], Boston, USA [http://www.bumc.bu.edu/microbiology/research/susan-h-fisher-phd/ homepage]
  • References

    Reviews

  • 10637624,17368911
  • Original Publications

  • 12823818,17001076,8799114,14600241,8282685,1670935,17220269,25229891,25755103