SubtiBank SubtiBank
ugtP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ugtP

UDP-glucose diacylglycerol glucosyltransferase, growth-rate dependent inhibitor of [category|SW 1.1.8|Cell division]
locus
BSU21920
pI
8.40
mw
43.40 kDa
protein length
382 aa Sequence Blast
gene length
1146 bp Sequence Blast
function
synthesis of glucolipids and anchoring of lipoteichoic acid, inhibition of [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ] assembly
product
UDP-glucose diacylglycerol glucosyltransferase
essential
no
ec
2.4.1.315
synonyms
ypfP

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.2|Other genes]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.3|Lipid metabolism/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,306,514 → 2,307,662

    Phenotypes of a mutant

  • cells are bent and distended due to the lack of glucolipids [Pubmed|22362028,27684739]
  • increased expression of the [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM], [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV], and [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX] regulons [Pubmed|22362028]
  • altered [SW|localization] of [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB] (irregular clusters instead of helical dots) [Pubmed|22362028]
  • the inactivation of ''[gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP]'' suppresses the poor and filamentous growth of the ''[gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA] [gene|EAD44AA7D72510B70308FD0C9F159DBEDAEBBB74|zapA]'' double mutant [Pubmed|24097947]
  • increased conjugation of ICEBs1 [Pubmed|25069588,26833415]
  • The protein

    Catalyzed reaction/ biological activity

  • UDP-glucose + 1,2-diacylglycerol = UDP + 1,2-diacyl-3-(O-beta-D-glucopyranosyl)-sn-glycerol (according to Swiss-Prot)
  • the interaction with [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ] results in inhibition of [SW|cell division] and an increase of cell size [Pubmed|22931116]
  • Effectors of protein activity

  • oligomerization of [protein|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|UgtP] is inhibited by UDP-Glc and by interaction with [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ] [Pubmed|22931116]
  • the amounts of [protein|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|UgtP] are reduced about threefold during growth with poor carbon sources due to [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]-dependent degradation (this requires most likely [protein|297F53DAD3351E0C55108DD2C93B78FFB174438C|ClpX] as the chaperone, but [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC] and [protein|8C5B14FE5E03427F9A598C75D4081FA0D6696299|ClpE] are also effective) [pubmed|29625553]
  • Structure

  • [PDB|4X1T] (galactolipid synthase from Arabidopsis thaliana, 25% identity) [pubmed|26935252]
  • [SW|Localization]

  • membrane-bound protein, self-assembles into tightly wound spirals ''in vitro'' [Pubmed|17662947]
  • under nutrient rich conditions (increased concentration of UDP-Glc): throughout the cell, concentrated at the cell poles and/or the cytokinetic ring, interaction with [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ] [Pubmed|22931116]
  • under nutrient poor conditions: forms punctate foci (oligomers), no interaction with [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ] [Pubmed|22931116]
  • Expression and Regulation

    Operons

    genes
    [gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • view in new tab

    genes
    [gene|1217330ECD588E24E42FF9FED2A097CEF32785F3|metA]-[gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • view in new tab

    additional information

  • the amounts of [protein|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|UgtP] are reduced about threefold during growth with poor carbon sources due to [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]-dependent degradation [pubmed|29625553]
  • Biological materials

    Mutant

  • MGNA-A886 (ypfP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/886 NBRP B. subtilis, Japan]
  • GP1369 (''[gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP]''::''spc''), available in [SW|Jörg Stülke]'s lab
  • BKE21920 (Δ[gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTAAATTCACCTCAATG, downstream forward: _UP4_TAATGGCGTACTTGAGAGCA
  • BKK21920 (Δ[gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTAAATTCACCTCAATG, downstream forward: _UP4_TAATGGCGTACTTGAGAGCA
  • Expression vectors

  • pGP2571, for expression in ''B. subtilis'' (based on [SW|pBQ200], available in [SW|Jörg Stülke]'s lab
  • pGP2600, for expression/ purification from ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 19680248,17662935,22575476,28993557
  • Original Publications

  • 9244290,18820022,17662947,9720862,22362028,15640167,23935518,22931116,24097947,25069588,27684739,26833415,26935252,29625553