SubtiBank SubtiBank
lcfA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

lcfA

long chain acyl-CoA synthetase, involved in surfactin production
locus
BSU_28560
pI
6.12
mw
62.52 kDa
protein length
560 aa Sequence Blast
gene length
1683 bp Sequence Blast
function
fatty acid degradation
product
long chain acyl-CoA synthetase
essential
no
ec
6.2.1.3
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.3|Utilization of fatty acids]
  • Gene

    Coordinates
    2,918,646 2,920,328

    The protein

    Catalyzed reaction/ biological activity

  • long-chain fatty acid + ATP + CoA --> long-chain fatty acyl-CoA + AMP + diphosphate (according to UniProt)
  • activates 3-hydroxy fatty acids for surfactin biosynthesis [Pubmed|20797616]
  • Protein family

  • [SW|ATP-dependent AMP-binding enzyme family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|41B879EF69E2D4F5C1896A4709567B88FD8AC5B7|LcfB], [protein|5050649605DD782AF10FC0AEEA5F14036EC0197D|YhfT], [protein|5F73ACDEAFC7F1EB26D55195100C3283FC1F587C|YngI]
  • Structure

  • [PDB|3R44] (Very-long-chain fatty acyl-CoA synthetase from Mycobacterium tuberculosis, 28% identity) [pubmed|22560731]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|7AC5217CA35F8E134ABB35D74F1BA5E684D2E058|lcfA]-[gene|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]-[gene|3111ECB66CD3CFF0494AA3DF4D646102CF3B0FA8|fadB]-[gene|251600E5FD52DC0352A123F1224C037577F5A09C|etfB]-[gene|ACA8FF923D72CC99F447E47F6A1381FEAD9DAB09|etfA]
    description
    [Pubmed|17189250]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21398533], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]: repression, [Pubmed|17189250], in [regulon|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|21398533], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by long chain acyl-CoA (C14 ... C20) ([protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]) [Pubmed|17189250]
  • expression of the operon is strongly induced during [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials

    Mutant

  • available in [SW|Mohamed Marahiel]'s lab [Pubmed|20797616]
  • 1A852 ( ''lcfA''::''cat''), [Pubmed|17085570], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A852&Search=1A852 BGSC]
  • BKE28560 ([gene|7AC5217CA35F8E134ABB35D74F1BA5E684D2E058|lcfA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAACCTCCCCTTTCGA, downstream forward: _UP4_TAAAAAAAGAGAACGCCTAT
  • BKK28560 ([gene|7AC5217CA35F8E134ABB35D74F1BA5E684D2E058|lcfA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAACCTCCCCTTTCGA, downstream forward: _UP4_TAAAAAAAGAGAACGCCTAT
  • References

  • 17189250,17919287,20797616,17085570,22900538,22560731,31113899