SubtiBank SubtiBank
mcsB
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

mcsB

protein arginine kinase, tags proteins for degradation by ClpCP, adaptor protein, modulator of CtsR-dependent repression
locus
BSU00850
pI
5.07
mw
40.97 kDa
protein length
363 aa Sequence Blast
gene length
1089 bp Sequence Blast
function
control of CtsR activity
product
protein arginine kinase
essential
no
synonyms
yacI

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.7|Control of transcription factor (other than two-component system)]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • Gene

    Coordinates
    102,484 → 103,575

    The protein

    Catalyzed reaction/ biological activity

  • phosphorylates and thereby targets non-functional CtsR for degradation by [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]/[protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC] [Pubmed|20852588]
  • Protein family

  • ATP:guanido phosphotransferase family (according to Swiss-Prot)
  • Modification

  • autophosphorylation on specific arginine residues [Pubmed|20852588,21622759], dephosphorylation by [protein|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|YwlE] [Pubmed|20852588,21622759]
  • autophosphorylation stimulates McsB activity as adaptor protein for [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC] [Pubmed|21622759]
  • Expression and Regulation

    Operons

    genes
    [gene|908DB17A39D518E84977250C55825E77FA02E391|ctsR]-[gene|CA0939064E70A97434FA450A69E779FD89880613|mcsA]-[gene|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB]-[gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]-[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]
    description
    [Pubmed|8793870]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8793870], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|8793870] [pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [pubmed|9987115,11179229,16163393,17380125], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]
  • regulation

  • expressed during germination and spore outgrowth [Pubmed|24244006]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B930 (yacI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1929 NBRP B. subtilis, Japan]
  • ''mcsB::aphA3'' availbale from the Gerth lab
  • mcsBC167S::spec available from the Gerth lab
  • GP1457 (''mcsB''::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • BP69 (spc), available in [SW|Fabian Commichau]'s lab
  • BKE00850 (Δ[gene|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGAATAAAATGCTTTAGCG, downstream forward: _UP4_AAAAGACAGGAGGATGAATC
  • BKK00850 (Δ[gene|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGAATAAAATGCTTTAGCG, downstream forward: _UP4_AAAAGACAGGAGGATGAATC
  • Expression vector

  • for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Gerth lab
  • expression of native ''mcsB'' in ''B. subtilis'': pBP186 (in [SW|pBQ200]), available in [SW|Fabian Commichau]'s lab
  • Antibody

  • available in Gerth lab
  • Labs working on this gene/protein

  • [SW|Ulf Gerth], Greifswald, Germany
  • [SW|Fabian Commichau] Göttingen, Germany
  • References

    Reviews

  • 23375660,19609260,28748186
  • Original Publications

  • 17380125,16163393,19498169,11179229,9987115,8793870,16497325,19226326,9987115,11544224,20852588,21622759,22517742,24825175,24263382,25610436,26458230,27749819