SubtiBank SubtiBank
mcsB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

mcsB

protein arginine kinase, tags proteins for degradation by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP], adaptor protein, modulator of [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]-dependent repression
locus
BSU_00850
pI
5.07
mw
40.97 kDa
protein length
363 aa Sequence Blast
gene length
1092 bp Sequence Blast
function
control of [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR] activity
product
protein arginine kinase
essential
no
synonyms
yacI

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.7|Control of transcription factor (other than two-component system)]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • Gene

    Coordinates
    102,484 103,575

    Phenotypes of a mutant

  • more rapid spore germination as compared to wild type cells [pubmed|31221751]
  • The protein

    Catalyzed reaction/ biological activity

  • phosphorylates and thereby targets non-functional [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR] for degradation by [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]/[protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC] [Pubmed|20852588]
  • phosphorylates and thereby targets [protein|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|MgsR] for degradation by [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]/[protein|297F53DAD3351E0C55108DD2C93B78FFB174438C|ClpX] [Pubmed|32477307]
  • ATP + L-arginyl-[protein] --> ADP + H+ + Nω-phospho-L-arginyl-[protein] (according to UniProt)
  • Protein family

  • ATP:guanido phosphotransferase family (single member, according to UniProt)
  • [SW|Domains]

  • Phosphagen kinase C-terminal (aa 24-254) (according to UniProt)
  • Modification

  • autophosphorylation on specific arginine residues [Pubmed|20852588,21622759], dephosphorylation by [protein|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|YwlE] [Pubmed|20852588,21622759]
  • autophosphorylation stimulates [protein|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|McsB] activity as adaptor protein for [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC] [Pubmed|21622759]
  • Structure

  • [PDB|6FH1] [pubmed|30962626]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|908DB17A39D518E84977250C55825E77FA02E391|ctsR]-[gene|CA0939064E70A97434FA450A69E779FD89880613|mcsA]-[gene|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB]-[gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]-[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]
    description
    [Pubmed|8793870]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8793870], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|8793870] [pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [pubmed|9987115,11179229,16163393,17380125], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]
  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [pubmed|30962353], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • expressed during germination and spore outgrowth [Pubmed|24244006]
  • induction during diamide stress ([protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]) [pubmed|30962353]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B930 (yacI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1929 NBRP B. subtilis, Japan]
  • ''mcsB::aphA3'' availbale from the Gerth lab
  • mcsBC167S::spec available from the Gerth lab
  • GP1457 (''mcsB''::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • BP69 (spc), available in [SW|Fabian Commichau]'s lab
  • BKE00850 ([gene|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGAATAAAATGCTTTAGCG, downstream forward: _UP4_AAAAGACAGGAGGATGAATC
  • BKK00850 ([gene|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGAATAAAATGCTTTAGCG, downstream forward: _UP4_AAAAGACAGGAGGATGAATC
  • Expression vectors

  • for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Gerth lab
  • expression of native ''mcsB'' in ''B. subtilis'': pBP186 (in [SW|pBQ200]), available in [SW|Fabian Commichau]'s lab
  • Antibody

  • available in Gerth lab
  • labs

  • [SW|Ulf Gerth], Greifswald, Germany
  • References

    Reviews

  • 23375660,19609260,28748186
  • Original Publications

  • 17380125,16163393,19498169,11179229,9987115,8793870,16497325,19226326,9987115,11544224,20852588,21622759,22517742,24825175,24263382,25610436,26458230,27749819,30962626,31221751,32477307,33101263