SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


phosphoribosylglycinamide formyltransferase, irreversible
21.63 kDa
protein length
195 aa Sequence Blast
gene length
588 bp Sequence Blast
purine biosynthesis
phosphoribosylglycinamide formyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    708,010 708,597

    The protein

    Catalyzed reaction/ biological activity

  • (6S)-10-formyltetrahydrofolate + N1-(5-phospho-D-ribosyl)glycinamide --> (6S)-5,6,7,8-tetrahydrofolate + H+ + N2-formyl-N1-(5-phospho-D-ribosyl)glycinamide (according to UniProt)
  • Protein family

  • GART family (single member, according to UniProt)
  • Paralogous protein(s)

  • [protein|9A399CAA672C3DF90531A7A7168916DE86EFA365|YkkE]
  • Structure

  • [PDB|3P9X] (from ''B. halodurans'', 51% identity, 70% similarity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials


  • BKE06510 ([gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGATGCAAATACCGCAAACT, downstream forward: _UP4_TTAAATAACAGAGGTGAAAA
  • BKK06510 ([gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGATGCAAATACCGCAAACT, downstream forward: _UP4_TTAAATAACAGAGGTGAAAA
  • References

  • 8121396,3036807,12923093,19574646,7638212