SubtiBank SubtiBank
yezC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yezC

similar to transcriptional regulator ([SW|Lrp family])
locus
BSU_06540
pI
8.22
mw
9.30 kDa
protein length
139 aa Sequence Blast
gene length
420 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    711,456 711,875

    The protein

    [SW|Domains]

  • [SW|HTH asnC-type domain] (aa 1-62) (according to UniProt)
  • Structure

  • [PDB|2P5V] (from Neisseria meningitidis, 33% identity) [pubmed|17374605]
  • Expression and Regulation

    Operons

    genes
    [gene|7B726F0FCE01A1F486D83B10D3F41A87B65F2DB5|yezC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A922 (yezC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/922 NBRP B. subtilis, Japan]
  • BKE06540 ([gene|7B726F0FCE01A1F486D83B10D3F41A87B65F2DB5|yezC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTCTGGCTCCTTTAC, downstream forward: _UP4_TGATAACAAAAAACCCGCAG
  • BKK06540 ([gene|7B726F0FCE01A1F486D83B10D3F41A87B65F2DB5|yezC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTCTGGCTCCTTTAC, downstream forward: _UP4_TGATAACAAAAAACCCGCAG
  • References

    Research papers

  • 17374605