SubtiBank SubtiBank
yezC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yezC

similar to transcriptional regulator ([SW|Lrp family])
locus
BSU_06540
pI
8.22
mw
9.30 kDa
protein length
139 aa Sequence Blast
gene length
420 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    711,456 711,875

    The protein

    Structure

  • [PDB|2P5V] (from Neisseria meningitidis, 33% identity) [pubmed|17374605]
  • Expression and Regulation

    Operons

    genes
    [gene|7B726F0FCE01A1F486D83B10D3F41A87B65F2DB5|yezC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A922 (yezC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/922 NBRP B. subtilis, Japan]
  • BKE06540 ([gene|7B726F0FCE01A1F486D83B10D3F41A87B65F2DB5|yezC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTCTGGCTCCTTTAC, downstream forward: _UP4_TGATAACAAAAAACCCGCAG
  • BKK06540 ([gene|7B726F0FCE01A1F486D83B10D3F41A87B65F2DB5|yezC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTCTGGCTCCTTTAC, downstream forward: _UP4_TGATAACAAAAAACCCGCAG
  • References

    Research papers

  • 17374605