SubtiBank SubtiBank
yneA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yneA

inhibits cell division during SOS response
locus
BSU_17860
pI
4.61
mw
11.75 kDa
protein length
105 aa Sequence Blast
gene length
318 bp Sequence Blast
function
inhibits cell division during SOS response
product
checkpoint enforcement protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.2|Other genes]
  • Gene

    Coordinates
    1,918,406 1,918,723

    Phenotypes of a mutant

  • increased sensitivity to DNA-damaging agents [Pubmed|23728628]
  • inactivation allows growth of a [gene|search|whiA ][gene|search|parB ]double mutant [pubmed|29378890]
  • The protein

    Protein family

  • YneA family (single member, according to UniProt)
  • [SW|Domains]

  • contains a N-acetylglucosamine-polymer-binding [SW|LysM domain] (aa 38-89) [Pubmed|20400548,18430080]
  • [SW|Localization]

  • secreted to the medium (signal peptide) [Pubmed|20400548]
  • Expression and Regulation

    Operons

    genes
    [gene|7BF591DCDC9635C605D76135481A8A9DB63EE861|yneA]-[gene|67074435B8FDA85C8ED4D8C4ECE3580C4EDFBF2A|yneB]-[gene|5BFD552F8A467C8D95FABE87CC8C5E7F04114886|ynzC]
    description
    [Pubmed|12581363]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|12581363], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]) [Pubmed|12581363]
  • additional information

  • YneA is rapidly degraded by extracellular proteases ([protein|5ED8301B9681FDD5171A9344A971E891493A6558|CtpA]) [PubMed|29979679,20400548]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B388 (yneA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1387 NBRP B. subtilis, Japan]
  • BKE17860 ([gene|7BF591DCDC9635C605D76135481A8A9DB63EE861|yneA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACCTCCAACAGGAATG, downstream forward: _UP4_AGATAGAGAGGAAAGAGAGA
  • BKK17860 ([gene|7BF591DCDC9635C605D76135481A8A9DB63EE861|yneA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACCTCCAACAGGAATG, downstream forward: _UP4_AGATAGAGAGGAAAGAGAGA
  • References

    Reviews

  • 22933559,18430080
  • Original publications

  • 12581363,20400548,16267290,23728628,29378890,16549676,29979679,30315724