SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


probable regulator of transcription of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]-dependent genes
29.58 kDa
protein length
258 aa Sequence Blast
gene length
777 bp Sequence Blast
control of expression of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]-dependent genes
regulator of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF] activity

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    3,861,437 3,862,213

    Phenotypes of a mutant

  • inactivation of ''[gene|7C0458DB0E3E3AC952FB9DDBC4AD220A3A456359|rsfA]'' reduces sporulation efficiency to 11.6% that of wild type cells [Pubmed|26735940]
  • The protein


  • Myb-like domain (aa 1-57) (according to UniProt)
  • [SW|Localization]

  • forespore (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325,10629188], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|10629188], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|7C0458DB0E3E3AC952FB9DDBC4AD220A3A456359|RsfA]: repression, in [regulon|7C0458DB0E3E3AC952FB9DDBC4AD220A3A456359|RsfA regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325,15699190,10629188]
  • view in new tab

    Biological materials


  • MGNA-A592 (ywfN::erm), available at the [ NBRP B. subtilis, Japan]
  • 1S132 ( ''rsfA''::''tet''), [Pubmed|10629188], available at [ BGSC]
  • BKE37620 ([gene|7C0458DB0E3E3AC952FB9DDBC4AD220A3A456359|rsfA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATCTCAACTCCCATT, downstream forward: _UP4_TGACATAGAAAAATCCCAAA
  • BKK37620 ([gene|7C0458DB0E3E3AC952FB9DDBC4AD220A3A456359|rsfA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATCTCAACTCCCATT, downstream forward: _UP4_TGACATAGAAAAATCCCAAA
  • References


  • 31350897
  • Original Publications

  • 16497325,10629188,7934828,12107147,15699190,26735940