SubtiBank SubtiBank
ypfD

ypfD

similar to ribosomal protein S1
locus
BSU_22880
pI
4.57
mw
42.24 kDa
protein length
382 aa Sequence Blast
gene length
1149 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
jofD

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.5|Ribosomal protein/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    2,394,664 2,395,812

    The protein

    Protein family

  • bacterial [SW|ribosomal protein] bS1 family (single member, according to UniProt)
  • [SW|Domains]

  • 4 reiterated [SW|S1 domain]s (aa 16-84, aa 102-167, aa 188-256, aa 273-342) (according to UniProt)
  • Modification

  • phosphorylation on Ser-243 [Pubmed|17218307]
  • Structure

  • [PDB|5X8R] (chloroplast, small ribosomal subunit, 37% identity to aa 14 .. 266) [pubmed|28582576]
  • [PDB|1SRO] (E. coli S1 RNA-binding domain, 37% identity to aa 185 ... 343) [pubmed|9008164]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|1ADB6E2C8DC82A242CFEFAD22443D14226F1BA60|cmk]-[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|1ADB6E2C8DC82A242CFEFAD22443D14226F1BA60|cmk]-[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]-[gene|E91624382EC3DAABFB3123CDA818B4BEF745ACE6|fni]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]-[gene|E91624382EC3DAABFB3123CDA818B4BEF745ACE6|fni]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|C194336ED96FA844FFE9FB43BE59ADC5D6DDB3BE|motI]-[gene|3459BA0CDAABC288ADF97B111F78C7EAC184840D|ypfB]-[gene|1ADB6E2C8DC82A242CFEFAD22443D14226F1BA60|cmk]-[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]-[gene|E91624382EC3DAABFB3123CDA818B4BEF745ACE6|fni]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|C194336ED96FA844FFE9FB43BE59ADC5D6DDB3BE|motI]-[gene|3459BA0CDAABC288ADF97B111F78C7EAC184840D|ypfB]-[gene|1ADB6E2C8DC82A242CFEFAD22443D14226F1BA60|cmk]-[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE22880 ([gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATAACCTCCTTGG, downstream forward: _UP4_TAATTGGTGATAAACGTGAC
  • BKK22880 ([gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATAACCTCCTTGG, downstream forward: _UP4_TAATTGGTGATAAACGTGAC
  • References

  • 17218307,20525796,23002217,15378759,28516784,28582576,9008164