SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


transcriptional termination protein, involved in balanced regulation of cell motility, [category|SW 4.1.2|Biofilm formation], and [category|SW 4.2|Sporulation]
48.51 kDa
protein length
427 aa Sequence Blast
gene length
1284 bp Sequence Blast
transcriptional termination
transcriptional termination protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Transcription elongation/ termination]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Signal transduction in motility and chemotaxis] → [category|SW|Additional chemotaxis signal transduction and regulatory proteins]
  • Gene

    3,803,400 3,804,683

    Phenotypes of a mutant

  • loss of motility due to poor expression of the [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon], this can be partially reversed by inactivation of [gene|920F91E748EE079FF864011D9052B073567C41E4|slrR] [pubmed|28723971]
  • no [category|SW 4.1.2|Biofilm formation], this can be suppressed by deletion of [gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR] and by switching of expression of the [gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]-[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA] antisense transcript [pubmed|28723971]
  • increased efficiency of [category|SW 4.2|Sporulation], due to enhanced [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A] phosphorylation [pubmed|28723971]
  • The protein

    Protein family

  • Rho family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|CSD domain] (aa 54-127) (according to the InterPro database)
  • Rho RNA-BD domain (aa 51-125) (according to UniProt)
  • Structure

  • [PDB|1PVO] (Rho from ''E. coli'') [Pubmed|12859904]
  • Expression and Regulation


    view in new tab

    Biological materials


  • GP2673 ([gene|7CD46C64BE69EDADF58B634DC50C3F61BFFEC5B5|rho]::''ermC''), available in [SW|Jörg Stülke]'s lab
  • BKE37080 ([gene|7CD46C64BE69EDADF58B634DC50C3F61BFFEC5B5|rho]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACACCACGCTTTT, downstream forward: _UP4_TAAATTGTATTTGCAAAAGA
  • BKK37080 ([gene|7CD46C64BE69EDADF58B634DC50C3F61BFFEC5B5|rho]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACACCACGCTTTT, downstream forward: _UP4_TAAATTGTATTTGCAAAAGA
  • References


  • 16946247,12887917,16946247,8576105,23347833,12887917,23704790,26796109,28731845,29094196
  • Original publications

  • 11566991,10027981,20075920,22383849,12859904,21040729,25112476,28723971,26857544,29931073,30845912