SubtiBank SubtiBank
rho
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rho

transcriptional termination protein, involved in balanced regulation of cell motility, [category|SW 4.1.2|Biofilm formation], and [category|SW 4.2|Sporulation]
locus
BSU_37080
pI
6.86
mw
48.51 kDa
protein length
427 aa Sequence Blast
gene length
1284 bp Sequence Blast
function
transcriptional termination
product
transcriptional termination protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.3|Transcription elongation/ termination]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.5|Additional chemotaxis signal transduction and regulatory proteins]
  • Gene

    Coordinates
    3,803,400 3,804,683

    Phenotypes of a mutant

  • loss of motility due to poor expression of the [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon], this can be partially reversed by inactivation of [gene|920F91E748EE079FF864011D9052B073567C41E4|slrR] [pubmed|28723971]
  • no [category|SW 4.1.2|Biofilm formation], this can be suppressed by deletion of [gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR] and by switching of expression of the [gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]-[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA] antisense transcript [pubmed|28723971]
  • increased efficiency of [category|SW 4.2|Sporulation], due to enhanced [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A] phosphorylation [pubmed|28723971]
  • The protein

    Protein family

  • Rho family (single member, according to UniProt)
  • Structure

  • [PDB|1PVO] (Rho from ''E. coli'') [Pubmed|12859904]
  • Expression and Regulation

    Operons

    genes
    [gene|7CD46C64BE69EDADF58B634DC50C3F61BFFEC5B5|rho]-[gene|035154A4160F084BA1CC124D0951937B203E167D|rpmE]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP2673 ([gene|7CD46C64BE69EDADF58B634DC50C3F61BFFEC5B5|rho]::''ermC''), available in [SW|Jörg Stülke]'s lab
  • BKE37080 ([gene|7CD46C64BE69EDADF58B634DC50C3F61BFFEC5B5|rho]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACACCACGCTTTT, downstream forward: _UP4_TAAATTGTATTTGCAAAAGA
  • BKK37080 ([gene|7CD46C64BE69EDADF58B634DC50C3F61BFFEC5B5|rho]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACACCACGCTTTT, downstream forward: _UP4_TAAATTGTATTTGCAAAAGA
  • References

    Reviews

  • 16946247,12887917,16946247,8576105,23347833,12887917,23704790,26796109,28731845,29094196
  • Original publications

  • 11566991,10027981,20075920,22383849,12859904,21040729,25112476,28723971,26857544,29931073,30845912