SubtiBank SubtiBank
ywtG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ywtG

general stress protein, similar to glucose transporter
locus
BSU_35830
pI
9.57
mw
49.03 kDa
protein length
457 aa Sequence Blast
gene length
1374 bp Sequence Blast
function
unknown
product
putative glucose transporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,692,533 3,693,906

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Sugar transporter (TC 2.A.1.1) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|8B0701B5694ABA8142476CB896E590FE1981D7DB|YfiG], [protein|A84AC4E40E7C722E27AE9C24ACECFEABD51B57BE|YncC], [protein|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|CsbC], [protein|4A77316AA94F9C11DB70AB76711AACBD28098AA1|IolT], [protein|770D9A5BEEEABE9C3FC772E74001329206ECFAB3|AraE]
  • Structure

  • [PDB|4LDS] (from Staphylococcus epidermidis, 52% identity) [pubmed|24127585]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|7CE5A42042E5D52768735E795DB805530691D8A6|ywtG]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A548 (ywtG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/548 NBRP B. subtilis, Japan]
  • BKE35830 ([gene|7CE5A42042E5D52768735E795DB805530691D8A6|ywtG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAGATGACTCCCTTTC, downstream forward: _UP4_TAAAAAAGGGTGCGCGATCA
  • BKK35830 ([gene|7CE5A42042E5D52768735E795DB805530691D8A6|ywtG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAGATGACTCCCTTTC, downstream forward: _UP4_TAAAAAAGGGTGCGCGATCA
  • References

  • 15805528,24127585