SubtiBank SubtiBank
amyX
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

amyX

pullulanase (debranching enzyme)
locus
BSU_29930
pI
5.80
mw
80.92 kDa
protein length
718 aa Sequence Blast
gene length
2157 bp Sequence Blast
function
starch degradation
product
pullulanase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.23|Utilization of starch/ maltodextrin]
  • Gene

    Coordinates
    3,061,651 3,063,807

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of (1->6)-alpha-D-glucosidic linkages in pullulan, amylopectin and glycogen, and in the alpha- and beta-limit dextrins of amylopectin and glycogen (according to UniProt)
  • Protein family

  • [SW|glycosyl hydrolase 13 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|52C8DE3C78B680C8883D1CD559CBC2D9ABFCC400|GlgB]
  • Structure

  • [PDB|2E8Z] (complex with alpha cyclodextrin), [PDB|2E9B] (complex with maltose)
  • Expression and Regulation

    Operons

    genes
    [gene|29A38D244A07ED0973D0846B652238524F4DBC67|ytlP]-[gene|DB1491F13F8B55A360413E815E47A2B51D24395C|ytlQ]-[gene|ED4C1EA16FF96DA20F12B972CD2458FA3B49DDA5|ytlR]-[gene|7D783DD180D950A4B030BF5EA78CCE930A466A07|amyX]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    genes
    [gene|7D783DD180D950A4B030BF5EA78CCE930A466A07|amyX]
    description
    [Pubmed|9387221]
    view in new tab

    Biological materials

    Mutant

  • BKE29930 ([gene|7D783DD180D950A4B030BF5EA78CCE930A466A07|amyX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGAAGCTCTCTCCTCC, downstream forward: _UP4_TGACGAAGTTTGTGCTATAG
  • BKK29930 ([gene|7D783DD180D950A4B030BF5EA78CCE930A466A07|amyX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGAAGCTCTCTCCTCC, downstream forward: _UP4_TGACGAAGTTTGTGCTATAG
  • References

  • 16582490,9387221,19465663,24793495,31028806,31028806