SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


type III polyketide synthase
40.55 kDa
protein length
365 aa Sequence Blast
gene length
1098 bp Sequence Blast
polyketide synthesis
type III polyketide synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    2,316,956 2,318,053

    The protein

    Catalyzed reaction/ biological activity

  • synthesis of triketide pyrones from long-chain fatty acyl CoA thioesters as starter substrates and malonyl-CoA as an extender substrate [Pubmed|19465653]
  • 4-coumaroyl-CoA + 2 H+ + 3 malonyl-CoA --> 2',4,4',6'-tetrahydroxychalcone + 3 CO2 + 4 CoA (according to UniProt)
  • Protein family

  • [SW|thiolase-like superfamily] (according to UniProt)
  • Structure

  • [PDB|4JAO] (from Mycobacterium tuberculosis, 34% identity) [pubmed|23615910]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A875 (bcsA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE22050 (''[gene|7D90F7AF49BAD6A95731BF805991DEBBBCAFA46C|bpsA]''::''erm'', available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • GP1820 (''[gene|7D90F7AF49BAD6A95731BF805991DEBBBCAFA46C|bpsA]''::''erm'', available in [SW|Jörg Stülke]'s lab)
  • BKE22050 ([gene|7D90F7AF49BAD6A95731BF805991DEBBBCAFA46C|bpsA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGATCACCTCTTTGCA, downstream forward: _UP4_AGCTGGGAAAAGGGGGCCTG
  • BKK22050 ([gene|7D90F7AF49BAD6A95731BF805991DEBBBCAFA46C|bpsA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGATCACCTCTTTGCA, downstream forward: _UP4_AGCTGGGAAAAGGGGGCCTG
  • References

  • 19465653,23615910