SubtiBank SubtiBank
kipR
The papers of the month are back! Check them out! Link here

kipR

transcriptional repressor of the kip operon
locus
BSU04100
pI
5.43
mw
27.16 kDa
protein length
246 aa Sequence Blast
gene length
738 bp Sequence Blast
function
regulation of sporulation initiation
product
transcriptional regulator
essential
no
synonyms
ycsO

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay]
  • Gene

    Coordinates
    461,615 → 462,367

    Expression and Regulation

    Operons

    genes
    [gene|77F758CE9A59AC41F283CB1F5099097386133799|pxpA]-[gene|9AD419E3CB86C54A0F11E96C82E80A357C6B23D2|ycsG]-[gene|312E2A4ADFBCB9DD9AD9EEEC9FE53F3932AF5DBA|ycsI]-[gene|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|pxpB]-[gene|3BA8F1F71B1D65EB30867ABD27867F925DAD2D7B|pxpC]-[gene|7DA9A79876C546B78B716A64706A3A3716018C2E|kipR]-[gene|05910B4500420D4DB75DAD3A7A2358C360FF2154|lipC]
    description
    [Pubmed|9334321]

    regulatory mechanism

  • [protein|7DA9A79876C546B78B716A64706A3A3716018C2E|KipR]: repression, [Pubmed|9334321], in [regulon|7DA9A79876C546B78B716A64706A3A3716018C2E|KipR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|9334321], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • induced in the presence of 5-oxoproline [pubmed|28830929]
  • view in new tab

    Biological materials

    Mutant

  • BKE04100 (Δ[gene|7DA9A79876C546B78B716A64706A3A3716018C2E|kipR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCTGCATCATTCATCCCC, downstream forward: _UP4_TAAGTAGCCAATCTTTTCTC
  • BKK04100 (Δ[gene|7DA9A79876C546B78B716A64706A3A3716018C2E|kipR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCTGCATCATTCATCCCC, downstream forward: _UP4_TAAGTAGCCAATCTTTTCTC
  • References

  • 9334321,25755103