SubtiBank SubtiBank
kipR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

kipR

transcriptional repressor of the kip operon
locus
BSU_04100
pI
5.43
mw
27.16 kDa
protein length
250 aa Sequence Blast
gene length
753 bp Sequence Blast
function
regulation of [SW|sporulation] initiation
product
transcriptional regulator
essential
no
synonyms
ycsO

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay]
  • Gene

    Coordinates
    461,615 462,367

    The protein

    Structure

  • [PDB|1MKM] (from Thermotoga maritima, 33% identity) [pubmed|11877432]
  • Expression and Regulation

    Operons

    genes
    [gene|77F758CE9A59AC41F283CB1F5099097386133799|pxpA]-[gene|9AD419E3CB86C54A0F11E96C82E80A357C6B23D2|ycsG]-[gene|312E2A4ADFBCB9DD9AD9EEEC9FE53F3932AF5DBA|ycsI]-[gene|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|pxpB]-[gene|3BA8F1F71B1D65EB30867ABD27867F925DAD2D7B|pxpC]-[gene|7DA9A79876C546B78B716A64706A3A3716018C2E|kipR]-[gene|05910B4500420D4DB75DAD3A7A2358C360FF2154|lipC]
    description
    [Pubmed|9334321]

    regulatory mechanism

  • [protein|7DA9A79876C546B78B716A64706A3A3716018C2E|KipR]: repression, [Pubmed|9334321], in [regulon|7DA9A79876C546B78B716A64706A3A3716018C2E|KipR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|9334321], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • induced in the presence of 5-oxoproline [pubmed|28830929]
  • view in new tab

    Biological materials

    Mutant

  • BKE04100 ([gene|7DA9A79876C546B78B716A64706A3A3716018C2E|kipR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCTGCATCATTCATCCCC, downstream forward: _UP4_TAAGTAGCCAATCTTTTCTC
  • BKK04100 ([gene|7DA9A79876C546B78B716A64706A3A3716018C2E|kipR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCTGCATCATTCATCCCC, downstream forward: _UP4_TAAGTAGCCAATCTTTTCTC
  • References

  • 9334321,25755103,11877432