SubtiBank SubtiBank
ybaF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybaF

trans-membrane T component of [SW|ECF transporter]s
locus
BSU_01470
pI
10.18
mw
29.54 kDa
protein length
265 aa Sequence Blast
gene length
798 bp Sequence Blast
function
uptake of micronutrients
product
[SW|ECF transporter] (membrane-spanning protein)
essential
no
synonyms
ecfT

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.3|ECF transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.3|ECF transporter] → [category|SW 1.2.3.1|The general components of the ECF transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    152,130 152,927

    The protein

    Protein family

  • energy-coupling factor EcfT family (single member, according to UniProt)
  • Structure

  • [PDB|4HUQ] (EcfA1-EcfA2-EcfT-FolT complex of ''Lactobacillus brevis''), [Pubmed|23584589]
  • [SW|Localization]

  • cell membrane [Pubmed|20497229]
  • Biological materials

    Mutant

  • MGNA-B945 (ybaF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1944 NBRP B. subtilis, Japan]
  • BKE01470 ([gene|7DC7BD54ED425859FFD45B8B6F3522750A938835|ybaF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTGCCGATAATCATGCTGT, downstream forward: _UP4_TTCTTAAGGGCTTAGAGGTG
  • BKK01470 ([gene|7DC7BD54ED425859FFD45B8B6F3522750A938835|ybaF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTGCCGATAATCATGCTGT, downstream forward: _UP4_TTCTTAAGGGCTTAGAGGTG
  • References

  • 10092453,20497229,22574898,24362466