SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to [SW|ABC transporter] for molybdenum uptake (binding protein)
28.21 kDa
protein length
260 aa Sequence Blast
gene length
783 bp Sequence Blast
[SW|ABC transporter] (binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of ions]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW|Trace metals/ Other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,425,272 3,426,054

    The protein

    Protein family

  • bacterial solute-binding protein ModA family (single member, according to UniProt)
  • Structure

  • [PDB|2H5Y] (from Xanthomonas citri, 33% identity) [pubmed|16511325]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B063 (yvgL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33380 ([gene|7DCC368C52FB0DA12D807919CFEB49E2625932D3|yvgL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTGCACCCCTTATCA, downstream forward: _UP4_GAAGCAATGAAAGTATTTGA
  • BKK33380 ([gene|7DCC368C52FB0DA12D807919CFEB49E2625932D3|yvgL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTGCACCCCTTATCA, downstream forward: _UP4_GAAGCAATGAAAGTATTTGA
  • References

  • 10092453,16511325