SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


scyllo-inositol dehydrogenase, general stress protein
39.95 kDa
protein length
358 aa Sequence Blast
gene length
1077 bp Sequence Blast
utilization of scyllo-inosose
scyllo-inositol dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of inositol]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    3,444,329 3,445,405

    The protein

    Catalyzed reaction/ biological activity

  • NADPH-dependent conversion of scyllo-inosose to scyllo-inositol [pubmed|20133360]
  • NADP+ + scyllo-inositol --> H+ + NADPH + scyllo-inosose (according to UniProt)
  • Protein family

  • [SW|Gfo/Idh/MocA family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|920C5750CB95102B073C32874D512E8D636D2C7D|IolU], [protein|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|IolG], [protein|942BAE9FA023DFCA06B6D26A856A72F2979E23FA|YrbE], [protein|AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06|IolX], [protein|03BE6DA854612B3F6741E0E167AB310F0DE96285|YfiI], [protein|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|NtdC], [protein|484D17480DFAD3667E0EBC6D38854A7546A8DB46|YteT]
  • [SW|Cofactors]

  • NADP+ [pubmed|20133360]
  • Structure

  • [PDB|3GFG]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials


  • MGNA-A443 (iolU::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33530 ([gene|7DFE74C751A67CCC84579D52005E1399B0A10166|iolW]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACAGAAGTATATACCCTC, downstream forward: _UP4_TAAAACAAAAGCCTCCCCAA
  • BKK33530 ([gene|7DFE74C751A67CCC84579D52005E1399B0A10166|iolW]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACAGAAGTATATACCCTC, downstream forward: _UP4_TAAAACAAAAGCCTCCCCAA
  • References

  • 15805528,20133360,24325193