SubtiBank SubtiBank
gntZ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gntZ

6-phosphogluconate dehydrogenase
locus
BSU_40080
pI
4.76
mw
51.82 kDa
protein length
468 aa Sequence Blast
gene length
1407 bp Sequence Blast
function
gluconate utilization
product
6-phosphogluconate dehydrogenase
essential
no
ec
1.1.1.44
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.13|Utilization of gluconate]
  • Gene

    Coordinates
    4,117,080 4,118,486

    The protein

    Catalyzed reaction/ biological activity

  • 6-phospho-D-gluconate + NAD+ --> CO2 + D-ribulose 5-phosphate + NADH (according to UniProt)
  • Protein family

  • 6-phosphogluconate dehydrogenase family (with [protein|C6CB4993032D8C2CC79A06C67925096F0AFE48CB|YqeC] and [protein|61B7C51EB7E74226890010B61D8E41C02189A453|GndA], according to UniProt)
  • Paralogous protein(s)

  • [protein|C6CB4993032D8C2CC79A06C67925096F0AFE48CB|YqeC], [protein|61B7C51EB7E74226890010B61D8E41C02189A453|GndA]
  • Structure

  • [PDB|2W8Z] (from Geobacillus stearothermophilus, 58% identity) [pubmed|19407374]
  • Expression and Regulation

    Operons

    genes
    [gene|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR]-[gene|72404FA6ECD62AEA3EFDB934DFB8DA581875605C|gntK]-[gene|C6810A4ACD51EB8D14E5B30163348058196266A1|gntP]-[gene|7E7187AA2DC172018A63A7B9CE48124F30311639|gntZ]
    description
    [pubmed|10746760,3020045]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3020045], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|GntR]: repression, [Pubmed|3020045], in [regulon|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|GntR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by gluconate ([protein|search|GntR]) [Pubmed|3020045]
  • view in new tab

    genes
    [gene|7E7187AA2DC172018A63A7B9CE48124F30311639|gntZ]
    description
    [Pubmed|2419835]

    regulation

  • induced by gluconate ([protein|search|GntR]) [Pubmed|3020045]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B679 (gntZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1678 NBRP B. subtilis, Japan]
  • BKE40080 ([gene|7E7187AA2DC172018A63A7B9CE48124F30311639|gntZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTTACAGCTCCTTCT, downstream forward: _UP4_TAACCTGTATTAAAAACACG
  • BKK40080 ([gene|7E7187AA2DC172018A63A7B9CE48124F30311639|gntZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTTACAGCTCCTTCT, downstream forward: _UP4_TAACCTGTATTAAAAACACG
  • References

  • 10746760,8288545,3037520,3020045,3011959,8370661,3020045,1659648,220817675,19407374