SubtiBank SubtiBank
rpmI
The papers of the month are back! Check them out! Link here

rpmI

ribosomal protein
locus
BSU28860
pI
12.52
mw
7.42 kDa
protein length
gene length
198 bp Sequence Blast
function
translation
product
ribosomal protein L35
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • Gene

    Coordinates
    2,952,615 → 2,952,815

    The protein

    Protein family

  • [SW|ribosomal protein] L35P family (according to Swiss-Prot)
  • Structure

  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • Additional information

  • the protein is significantly underrepresented in 45S assembly intermediates that accumulate upon depletion of [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|RbgA] [Pubmed|24335279,23700310]
  • Expression and Regulation

    Operons

    genes
    [gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC]-[gene|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|rpmI]-[gene|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|rplT]-[gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA]
    description
    [Pubmed|17289755]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|RplT]: termination, via binding to a [SW|RNA switch] in the [gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC] leader region causes transcription termination, in [regulon|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|RplT regulon]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • additional information

  • autorepression of [gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC]-[gene|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|rpmI]-[gene|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|rplT]-[gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA] expression upon binding of excess [protein|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|RplT] to the untranslated region of the mRNA [Pubmed|29925569,17616982]
  • expression of [protein|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|IF3 ]is uncoupled from that of [protein|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|L35 ]and [protein|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|L20 ]by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y]-dependent mRNA processing [PubMed|21843271]
  • the [SW|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE28860 (Δ[gene|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|rpmI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGATTTCCTCCTTATT, downstream forward: _UP4_TAATCGGATAAGGAACAATT
  • BKK28860 (Δ[gene|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|rpmI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGATTTCCTCCTTATT, downstream forward: _UP4_TAATCGGATAAGGAACAATT
  • References

  • 19653700,17289755,11948165,21843271,23002217,24335279,23700310,25903689,29925569