SubtiBank SubtiBank
scoB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

scoB

succinyl CoA:3-oxoacid CoA-transferase (subunit B)
locus
BSU_38980
pI
4.89
mw
23.18 kDa
protein length
216 aa Sequence Blast
gene length
651 bp Sequence Blast
function
3-hydroxybutyrate utilization
product
succinyl CoA:3-oxoacid CoA-transferase (subunit B)
essential
no
ec
2.8.3.5
synonyms
yxjE

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.3|Utilization of fatty acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    4,001,329 4,001,979

    The protein

    Catalyzed reaction/ biological activity

  • 3-oxo acid + succinyl-CoA --> 3-oxoacyl-CoA + succinate (according to UniProt)
  • Protein family

  • 3-oxoacid CoA-transferase subunit B family (with [protein|138832210AC94B17E081F3D0AF9BCFE3BE63E601|YodR], according to UniProt)
  • Paralogous protein(s)

  • [protein|138832210AC94B17E081F3D0AF9BCFE3BE63E601|YodR]
  • Structure

  • [PDB|3CDK] (the [protein|A7E61C3D12BBDDD3EFD65B1EDBE280497D7B6CD0|ScoA]-[protein|7F46EDA8F1EB8D9817C62D7D361FF32F9CD814AD|ScoB] complex)
  • Expression and Regulation

    Operons

    genes
    [gene|B416BB368A96926526458B2258BF8AB928D7C15E|hbuT]-[gene|A7E61C3D12BBDDD3EFD65B1EDBE280497D7B6CD0|scoA]-[gene|7F46EDA8F1EB8D9817C62D7D361FF32F9CD814AD|scoB]-[gene|B7B1D28E50244704324920E5A6F110DA8D63F6C0|yxjF]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135,10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|12662922]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B729 (yxjE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1728 NBRP B. subtilis, Japan]
  • BKE38980 ([gene|7F46EDA8F1EB8D9817C62D7D361FF32F9CD814AD|scoB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCACTTGGCCTCACCCTT, downstream forward: _UP4_AATTCTTAATGGGAAGGTGT
  • BKK38980 ([gene|7F46EDA8F1EB8D9817C62D7D361FF32F9CD814AD|scoB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCACTTGGCCTCACCCTT, downstream forward: _UP4_AATTCTTAATGGGAAGGTGT
  • References

  • 17363272,10746760,16672620,12662922,12850135,10666464