SubtiBank SubtiBank
yycR
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yycR

similar to formaldehyde dehydrogenase
locus
BSU_40250
pI
5.79
mw
42.79 kDa
protein length
408 aa Sequence Blast
gene length
1227 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    4,135,798 4,137,024

    The protein

    Protein family

  • [SW|zinc-containing alcohol dehydrogenase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|EA4CC0D36C39957DBBF9B1B11F65F33E8CD81FFE|AdhB]:
  • Structure

  • [PDB|4JLW] (from Pseudomonas aeruginosa) [pubmed|23989142]
  • Expression and Regulation

    Operons

    genes
    [gene|7F4C5AD47D167683F96CC2841039512E70CC4F1C|yycR]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B816 (yycR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1815 NBRP B. subtilis, Japan]
  • BKE40250 ([gene|7F4C5AD47D167683F96CC2841039512E70CC4F1C|yycR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATGTGTTTGGACTCT, downstream forward: _UP4_TAAAAGAAAAAGCCGGACGT
  • BKK40250 ([gene|7F4C5AD47D167683F96CC2841039512E70CC4F1C|yycR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATGTGTTTGGACTCT, downstream forward: _UP4_TAAAAGAAAAAGCCGGACGT
  • References

    Research papers

  • 23989142