SubtiBank SubtiBank
yrbC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yrbC

similar to E. coli YebC putative transcription factor
locus
BSU_27820
pI
4.43
mw
26.56 kDa
protein length
240 aa Sequence Blast
gene length
723 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,843,106 2,843,828

    The protein

    Protein family

  • TACO1 family (with [protein|227EC2A232A989ACE986726BD76CF5648C4CFA19|YeeI], according to UniProt)
  • Paralogous protein(s)

  • [protein|227EC2A232A989ACE986726BD76CF5648C4CFA19|YeeI]
  • Structure

  • [PDB|1KON] (from E. coli, 50% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|7F690393007F0BE9BC375256ECC59228AE5174B5|yrbC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A009 (yrbC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/9 NBRP B. subtilis, Japan]
  • BKE27820 ([gene|7F690393007F0BE9BC375256ECC59228AE5174B5|yrbC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCACCTTCTTTTA, downstream forward: _UP4_TAAAAAACCGGCACGAGGTC
  • BKK27820 ([gene|7F690393007F0BE9BC375256ECC59228AE5174B5|yrbC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCACCTTCTTTTA, downstream forward: _UP4_TAAAAAACCGGCACGAGGTC