SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


large conductance mechanosensitive channel protein, prevents selective release of cytoplasmic proteins in a hypotonic environment
14.14 kDa
protein length
130 aa Sequence Blast
gene length
393 bp Sequence Blast
resistance to osmotic downshock, glycine betaine export
large conductance mechanosensitive channel protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.7|Coping with hypo-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,743,267 3,743,659

    Phenotypes of a mutant

  • sensitive to osmotic downshock (> 0.5 M) during logarithmic growth [Pubmed|19252899]
  • The protein

    Protein family

  • mscL family (single member, according to UniProt)
  • Structure

  • [PDB|3HZQ] (MscL of ''Staphylococcus aureus'') [Pubmed|19701184]
  • [SW|Localization]

  • cell membrane [Pubmed|19252899]
  • Expression and Regulation




  • expressed in logarithmic phase [Pubmed|19252899]
  • view in new tab

    Biological materials


  • MGNA-A562 (ywpC::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A957 ( ''mscL''::''spec''), [Pubmed|18310427], available at [ BGSC]
  • BKE36360 ([gene|7F7BC285A1D02B031575BA7E980293CD2962C84A|mscL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAATCACCTGCTTTTC, downstream forward: _UP4_TAAAAAAGATGCCGTTAGAA
  • BKK36360 ([gene|7F7BC285A1D02B031575BA7E980293CD2962C84A|mscL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAATCACCTGCTTTTC, downstream forward: _UP4_TAAAAAAGATGCCGTTAGAA
  • References


  • 12626684,19727188,20825352,22685280,24258154,22685280,24607989,17505523
  • Original Publications

  • 17665170,18310427,19160392,16897034,19252899,19701184,9632260,19738010,9353933
  • Labs working on this gene/protein

  • [SW|Jan Maarten van Dijl], Groningen, Netherlands
  • [SW|Erhard Bremer], University of Marburg, Germany [ homepage]