SubtiBank SubtiBank
yopR
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yopR

unknown
locus
BSU_20790
pI
6.04
mw
37.41 kDa
protein length
325 aa Sequence Blast
gene length
978 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,204,192 2,205,169

    Expression and Regulation

    Operons

    genes
    [gene|8B15C7311E9791DC1FF29FF1A46ECC70E93FE2F4|yopM]-[gene|01BE35FB190DDC77BE19C013A8E0D980B132CBE1|yopN]-[gene|E1B90896149DBA399174478D412DCDC242AB1834|yopO]-[gene|30D16B0061BBE33B6B53F219A6654A40F2185C53|yopP]-[gene|25F9A95D40FD5FA1114A1938D6B0DE2368B8689E|yopQ]-[gene|7F82DED7C941BC501B6F810BF6541780AB87EDDD|yopR]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|25F9A95D40FD5FA1114A1938D6B0DE2368B8689E|yopQ]-[gene|7F82DED7C941BC501B6F810BF6541780AB87EDDD|yopR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE20790 ([gene|7F82DED7C941BC501B6F810BF6541780AB87EDDD|yopR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCAACAAACAACTCCT, downstream forward: _UP4_TAAATATGAAATCCATTTGA
  • BKK20790 ([gene|7F82DED7C941BC501B6F810BF6541780AB87EDDD|yopR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCAACAAACAACTCCT, downstream forward: _UP4_TAAATATGAAATCCATTTGA