SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


acetylornithine transaminase
40.74 kDa
protein length
385 aa Sequence Blast
gene length
1155 bp Sequence Blast
biosynthesis of arginine
acetylornithine transaminase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of arginine]
  • Gene

    1,198,099 → 1,199,256

    The protein

    Catalyzed reaction/ biological activity

  • 2-oxoglutarate + N2-acetyl-L-ornithine --> L-glutamate + N-acetyl-L-glutamate 5-semialdehyde (according to UniProt)
  • Protein family

  • [SW|Class-III pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|2EH6] (from Aquifex aeolicus, 45% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7511775], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: repression, [Pubmed|1312212], in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|24843172], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • repressed by arginine ([protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]) [Pubmed|1312212]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials


  • BKE11220 (Δ[gene|7FA5502FE82D55EC176F68B74B24293EC9B7D4D7|argD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTCATGAAACAGCCTCCTT, downstream forward: _UP4_TGATTTTTTTTCGATATAAA
  • BKK11220 (Δ[gene|7FA5502FE82D55EC176F68B74B24293EC9B7D4D7|argD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTCATGAAACAGCCTCCTT, downstream forward: _UP4_TGATTTTTTTTCGATATAAA
  • References

  • 6096675,24843172,12107147,1312212,7511775