SubtiBank SubtiBank
fruR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

fruR

transcription repressor of the fruR-fruK-fruA operon, DeoR family
locus
BSU_14380
pI
5.68
mw
27.67 kDa
protein length
251 aa Sequence Blast
gene length
756 bp Sequence Blast
function
regulation of fructose utilization
product
transcription repressor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.7|Utilization of fructose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    1,507,578 1,508,333

    Expression and Regulation

    Operons

    genes
    [gene|7FD2294B0538EB6D83DC3E0752600D2464CDE4A3|fruR]-[gene|502AA809C8C95F8886DD91FBB7DDBECC63342327|fruK]-[gene|973C3D3FBFDCA095A760C5F49A96D8BE48771014|fruA]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|7FD2294B0538EB6D83DC3E0752600D2464CDE4A3|FruR]: repression, (according to [http://dbtbs.hgc.jp/COG/prom/fruRKA.html DBTBS]), in [regulon|7FD2294B0538EB6D83DC3E0752600D2464CDE4A3|FruR regulon]
  • regulation

  • induced in the presence of fructose ([protein|7FD2294B0538EB6D83DC3E0752600D2464CDE4A3|FruR]) (according to [http://dbtbs.hgc.jp/COG/prom/fruRKA.html DBTBS])
  • view in new tab

    Biological materials

    Mutant

  • BKE14380 ([gene|7FD2294B0538EB6D83DC3E0752600D2464CDE4A3|fruR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTCACCTCCTAATGA, downstream forward: _UP4_ACTGTCGTAAAGGTAGTGAA
  • BKK14380 ([gene|7FD2294B0538EB6D83DC3E0752600D2464CDE4A3|fruR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTCACCTCCTAATGA, downstream forward: _UP4_ACTGTCGTAAAGGTAGTGAA
  • References

  • 14651647,10627040