SubtiBank SubtiBank
fbaA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

fbaA

fructose 1,6-bisphosphate aldolase, glycolytic/ gluconeogenic enzyme
locus
BSU_37120
pI
5.03
mw
30.25 kDa
protein length
285 aa Sequence Blast
gene length
858 bp Sequence Blast
function
enzyme in glycolysis/ gluconeogenesis
product
fructose-1,6-bisphosphate aldolase
essential
no
ec
4.1.2.13
synonyms
fba,fba1,tsr

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.1|Glycolysis]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.2|Gluconeogenesis]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    Coordinates
    3,808,512 3,809,369

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|23420519]
  • The protein

    Catalyzed reaction/ biological activity

  • β-D-fructose 1,6-bisphosphate --> D-glyceraldehyde 3-phosphate + dihydroxyacetone phosphate (according to UniProt)
  • Protein family

  • class II fructose-bisphosphate aldolase family (with [protein|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|IolJ], according to UniProt)
  • Paralogous protein(s)

  • [protein|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|IolJ]
  • [SW|Domains]

  • 2 x Dihydroxyacetone phosphate binding domain (210212), (231234)
  • Modification

  • phosphorylation on Thr-212 and Thr-234 [Pubmed|17218307]
  • [SW|Cofactors]

  • Zn2+ (Metalloenzyme)
  • Effectors of protein activity

  • Inhibited by alpha-ketoglutarate, oxaloacetate and pyruvate [Pubmed|24624] [Pubmed|15125960]
  • Activated by NH4+ [Pubmed|15125960]
  • Structure

  • [PDB|3Q94] (from ''Bacillus anthracis'')
  • Additional information

  • Binds 2 zinc ions per subunit. One is catalytic and the other provides a structural contribution
  • extensive information on the structure and enzymatic properties of FbaA can be found at [http://www.proteopedia.org/wiki/index.php/Fructose_Bisphosphate_Aldolase Proteopedia]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|800EC1F1CA8C4F2A643EDECBB684347C29CAB0CA|fbaA]
    description
    [Pubmed|11489127]

    regulation

  • constitutively expressed [Pubmed|11489127]
  • view in new tab

    genes
    [gene|800EC1F1CA8C4F2A643EDECBB684347C29CAB0CA|fbaA]-[gene|1419F2F99D924973D75EE6FAA41F9A27EC5283E1|ywjH]
    description
    [Pubmed|11489127]

    regulation

  • constitutively expressed [Pubmed|11489127]
  • view in new tab

    Biological materials

    Mutant

  • GP591 (''fbaA''::''cat''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]
  • GP596 (''fbaA''::''erm''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]
  • BKE37120 ([gene|800EC1F1CA8C4F2A643EDECBB684347C29CAB0CA|fbaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGAATGTCCTCCTTA, downstream forward: _UP4_TAATTCAATTGGAACTTTTT
  • BKK37120 ([gene|800EC1F1CA8C4F2A643EDECBB684347C29CAB0CA|fbaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGAATGTCCTCCTTA, downstream forward: _UP4_TAATTCAATTGGAACTTTTT
  • Expression vectors

  • for expression in ''B. subtilis'', in [SW|pBQ200]: pGP1423, available in [SW|Jörg Stülke]'s lab
  • for expression/ purification from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], in [SW|pGP380]: pGP88, available in [SW|Jörg Stülke]'s lab, [pubmed|19193632]
  • for expression/ purification from ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP395, available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP601 (in [SW|pAC6]), available in [SW|Jörg Stülke]'s lab [pubmed|11489127]
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab [pubmed|19193632]
  • References

    Reviews

  • 25267444
  • Original publications

  • 17218307,15125960,24624,16843441,11489127,20525796,23420519,23033921,24571712,15378759