SubtiBank SubtiBank
sigY
The papers of the month are back! Check them out! Link here

sigY

[SW|RNA polymerase] ECF-type [SW|sigma factor] SigY
locus
BSU38700
pI
9.55
mw
21.21 kDa
protein length
178 aa Sequence Blast
gene length
534 bp Sequence Blast
function
maintenance of the SPß prophage
product
[SW|RNA polymerase] ECF-type [SW|sigma factor] SigY
essential
no
synonyms
yxlB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.2|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.1|Sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    3,970,312 → 3,970,848

    Phenotypes of a mutant

  • loss of the [[SPß prophage]] [Pubmed|22400495]
  • sensitive to killing by [protein|1A6D90298D039FFFD977B2534952BA5E32B3530F|sublancin]]] [Pubmed|22400495]
  • no production of [protein|1A6D90298D039FFFD977B2534952BA5E32B3530F|sublancin]]] [Pubmed|22400495]
  • The protein

    Protein family

  • ECF subfamily (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|801E92306971E26AD4AB155172B7F4EFDE2F9170|sigY]-[gene|C07156CBA0AA3BAB24D17D15708FC68E74A854A7|yxlC]-[gene|CAADFAFD4C39362D0D0F242C926AE101C683EB5D|yxlD]-[gene|B40D01DDD9EF8B64E46CA7DBF4BAC3DBF8A73986|yxlE]-[gene|D246F61BEAE0D3D6707B4C43A634C02876CC5395|yxlF]-[gene|DCC03844AC58A198B851B564D0A6459C39EBDA2F|yxlG]
    description
    [Pubmed|14769884]

    sigma factors

  • [protein|801E92306971E26AD4AB155172B7F4EFDE2F9170|SigY]: sigma factor, [Pubmed|12897008], in [regulon|801E92306971E26AD4AB155172B7F4EFDE2F9170|SigY regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B751 (sigY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1750 NBRP B. subtilis, Japan]
  • 1A909 ( ''sigY''::''erm''), [Pubmed|12897008], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A909&Search=1A909 BGSC]
  • BKE38700 (Δ[gene|801E92306971E26AD4AB155172B7F4EFDE2F9170|sigY]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGACCGTGATCCCCCCT, downstream forward: _UP4_CAGCAAATCAGAAAGGAGTG
  • BKK38700 (Δ[gene|801E92306971E26AD4AB155172B7F4EFDE2F9170|sigY]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGACCGTGATCCCCCCT, downstream forward: _UP4_CAGCAAATCAGAAAGGAGTG
  • References

    Reviews

  • 24921931
  • The [SW|SigY regulon]

  • 17675383
  • Other original publications

  • 14993308,14769884,12897008,20817771,22400495,27137497,27137497