SubtiBank SubtiBank
ywdA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ywdA

unknown
locus
BSU_38030
pI
7.09
mw
9.42 kDa
protein length
gene length
249 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ipa-51d

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,901,868 3,902,116

    Expression and Regulation

    Operons

    genes
    [gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]-[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]-[gene|803ED978141A0E09F1F9CAECAB4BA839D480241F|ywdA]
    description
    [Pubmed|3100393]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8702561], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6796E1C147AA21E919A42A953884DC24E182F430|SacT]: antitermination, via binding to a [SW|RNA switch], in [regulon|6796E1C147AA21E919A42A953884DC24E182F430|SacT regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by sucrose ([protein|search|SacT]) [Pubmed|2163394]
  • view in new tab

    Biological materials

    Mutant

  • BKE38030 ([gene|803ED978141A0E09F1F9CAECAB4BA839D480241F|ywdA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAAAACAACTCCTTTTA, downstream forward: _UP4_TAAACAGGCTGCCGATGGGA
  • BKK38030 ([gene|803ED978141A0E09F1F9CAECAB4BA839D480241F|ywdA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAAAACAACTCCTTTTA, downstream forward: _UP4_TAAACAGGCTGCCGATGGGA
  • References

  • 3100393,8702561,2163394,8702561