SubtiBank SubtiBank
yoyD
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yoyD

unknown
locus
BSU_19579
pI
9.00
mw
7.00 kDa
protein length
gene length
201 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,130,177 2,130,377

    Expression and Regulation

    Operons

    genes
    [gene|80D8589800BC9BA6743534311B6F227A37E7DB2D|yoyD]-[gene|7E86EB6FF86F2C4AE3FD11DB8CE8E71696D94B1B|yodF]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|25755103,12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • BKE19579 ([gene|80D8589800BC9BA6743534311B6F227A37E7DB2D|yoyD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19579 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTACTTTCCTCCTGAAA, downstream forward: _UP4_AAAAAAGATGGAGGACTTGA
  • BKK19579 ([gene|80D8589800BC9BA6743534311B6F227A37E7DB2D|yoyD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19579 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTACTTTCCTCCTGAAA, downstream forward: _UP4_AAAAAAGATGGAGGACTTGA
  • References

  • 24843172,25755103,27766092