SubtiBank SubtiBank
yfhI [2018-09-03 18:15:32]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yfhI [2018-09-03 18:15:32]

similar to antibiotic resistance protein
41.37 kDa
protein length
397 aa Sequence Blast
gene length
1191 bp Sequence Blast

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    926,886 → 928,079

    The protein

    Protein family

  • major facilitator superfamily (according to Swiss-Prot)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C362 (yfhI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08540 (Δ[gene|80E461C8847BC43F7E018793E68E84C23EFBD2E9|yfhI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTCATCGCCTCCTTTG, downstream forward: _UP4_TAAAAAACAGCTGCAGTGTA
  • BKK08540 (Δ[gene|80E461C8847BC43F7E018793E68E84C23EFBD2E9|yfhI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTCATCGCCTCCTTTG, downstream forward: _UP4_TAAAAAACAGCTGCAGTGTA