SubtiBank SubtiBank
recO
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

recO

mediator of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] binding to ssDNA, required for the formation of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] DNA repair centers, required for efficient survival and replication restart after replication-transcription conflicts
locus
BSU_25280
pI
8.21
mw
29.20 kDa
protein length
255 aa Sequence Blast
gene length
768 bp Sequence Blast
function
DNA repair/ recombination
product
mediator of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] binding to ssDNA
essential
no
synonyms
yqxN,yqfI

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • Gene

    Coordinates
    2,608,946 2,609,713

    Phenotypes of a mutant

  • drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]
  • ''[gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO] [gene|BA755FA1CB1E0C006E9A23489A7C8997141AA498|recJ]'' double mutants are extremely sensitive against DNA damaging agents [Pubmed|26001966]
  • ''[gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO] [gene|FC53216F600994C862F0C0D017C3FA28EB75DCB6|dprA]'' double mutants have a strongly reduced chromosomal transformation rate [Pubmed|23779106,22373918]
  • ''[gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO] [gene|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|addA]-[gene|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|addB]'' double mutants are extremely sensitive against DNA damaging agents [Pubmed|26001966]
  • reduced viability of a [gene|48BCA38E609E443406E03A32D2BB8DA2E9915A71|rarA] [gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO] double mutant [pubmed|32117122]
  • suppression of lethality of [gene|C73E52D214E24F21696973B19B0A44CE785D6FBA|pcrA] inactivation [pubmed|32793628]
  • The protein

    Catalyzed reaction/ biological activity

  • provides [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] access to ssDNA during chromosomal transformation (together with [protein|FC53216F600994C862F0C0D017C3FA28EB75DCB6|DprA]) [Pubmed|22373918]
  • catalyzes annealing of [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SsbA] or [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SsbA]/[protein|1CDF658441061EA476E27C2E60DEE45C4F45AC15|SsbB] coated ssDNAs to allow the formation of DNA duplexes with tails during plasmid transformation [Pubmed|22373918]
  • required for the formation of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] DNA repair centers (together with [protein|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|RecR]) [Pubmed|24891441]
  • anneals [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SsbA]- or [protein|1CDF658441061EA476E27C2E60DEE45C4F45AC15|SsbB]-coated complementary strands of transfecting SPP1 phage DNA, yielding tailed SPP1 duplex intermediates [pubmed|31876108]
  • [protein|FC53216F600994C862F0C0D017C3FA28EB75DCB6|DprA], [protein|80E6F156764FF30300D034EE6FB44F2DB8338AF3|RecO] or viral single strand annealing G35P protein, may catalyze the annealing of complete linear phage genomes with redundant regions at the ends of the molecule, alone or with the help of an exonuclease, to produce a circular unit-length duplex viral genome ready to initiate replication [pubmed|31876108]
  • Protein family

  • recO family (single member, according to UniProt)
  • Structure

  • [PDB|2V1C] (the [protein|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|RecR]-[protein|80E6F156764FF30300D034EE6FB44F2DB8338AF3|RecO] complex from ''Deinococcus radiodurans'', [protein|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|RecR]: 52% identity, 78% similarity, [protein|80E6F156764FF30300D034EE6FB44F2DB8338AF3|RecO]: 30%/ 58%) [Pubmed|17581636]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • localizes to the DNA entry pole during transformation [Pubmed|22373918]
  • Expression and Regulation

    Operons

    genes
    [gene|0E9E9615CE056BEA2B65C494D946EB45F42A3064|cdd]-[gene|CB68B3393CA7862C45C624AF7B1ADD188243A01F|era]-[gene|33FBC31E8C24177137B0BDD8B46C1AFFD7F7B038|yqzL]-[gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|6330116], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|6330116], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials

    Mutant

  • GP3527 (Δ[gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO]::kan), available in [SW|Jörg Stülke]'s lab
  • MGNA-C494 (yqxN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2492 NBRP B. subtilis, Japan]
  • 1A892 ( ''recO''::''cat''), [Pubmed|10323239], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A892&Search=1A892 BGSC]
  • BG128 (Δ[gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO]::cat), available in [SW|Juan Alonso]'s and [SW|Jörg Stülke]'s labs [pubmed|9642195]
  • BP738 ( Δ''recO''::''tet''), (available in [SW|Fabian Commichau]'s lab)
  • BP774 ( Δ''recO''::''ermC''), (available in [SW|Fabian Commichau]'s lab)
  • BKE25280 (Δ[gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCGCACCTTCCTCAA, downstream forward: _UP4_TGACATTTGGTCCATCTTTT
  • BKK25280 (Δ[gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCGCACCTTCCTCAA, downstream forward: _UP4_TGACATTTGGTCCATCTTTT
  • References

    Reviews

  • 22933559,32286623
  • Original publications

  • 24891441,18599486,19730681,20581116,22373918,17581636,21170359,24285298,24285298,25939832,26001966,15186413,10323239,26786319,23779106,30401797,31876108,32117122,32793628