SubtiBank SubtiBank
ythB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ythB

cytochrome bd2, menaquinol oxidase (7:1 protons)
locus
BSU_30720
pI
9.18
mw
38.69 kDa
protein length
346 aa Sequence Blast
gene length
1041 bp Sequence Blast
function
respiration
product
cytochrome bd2, menaquinol oxidase (7:1 protons)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.1|Terminal oxidases]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,140,806 3,141,846

    The protein

    Protein family

  • cytochrome ubiquinol oxidase subunit 2 family (with [protein|E66EAB3C172ED8D1D26C675A7338B8153FB66987|CydB], according to UniProt)
  • Structure

  • [PDB|5DOQ] (from Geobacillus thermodenitrificans, 33% identity) [pubmed|27126043]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|EB8AF295A11F28BDFAE39038FA89890824FC7791|ythA]-[gene|813E4BBEC8701114503ACD66DD6FE5A06B6B5E5F|ythB]-[gene|74DEE21BF65279A02A64EFCB60A06573F7C46B19|ytzL]
    description
    [Pubmed|22383849]

    regulation

  • expressed during [SW|sporulation] [Pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A290 (ythB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/290 NBRP B. subtilis, Japan]
  • BKE30720 ([gene|813E4BBEC8701114503ACD66DD6FE5A06B6B5E5F|ythB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTACGATCTTCCTTC, downstream forward: _UP4_TAGAGGGCAAGCCAGCCGGC
  • BKK30720 ([gene|813E4BBEC8701114503ACD66DD6FE5A06B6B5E5F|ythB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTACGATCTTCCTTC, downstream forward: _UP4_TAGAGGGCAAGCCAGCCGGC
  • References

  • 11073895,10551842,27126043