SubtiBank SubtiBank
ribT
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ribT

similar to dioxin reductive etherase
locus
BSU_23240
pI
5.75
mw
14.43 kDa
protein length
124 aa Sequence Blast
gene length
375 bp Sequence Blast
function
unknown
product
dioxin reductive etherase
essential
no
synonyms
ribD

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,427,405 2,427,779

    The protein

    [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 3-124) (according to UniProt)
  • Structure

  • [PDB|5XXS] [pubmed|29241954]
  • Expression and Regulation

    Operons

    genes
    [gene|3DFCF7C5FE15C9A3E9E7E4B0DA8E926B85DBD180|ribD]-[gene|4E18BD4B084094EE4FBC8FE2AC95B14581D20C0F|ribE]-[gene|F07B7062C850106A95C15978E36DA500F8B089D6|ribA]-[gene|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|ribH]-[gene|8146A052E4E7844F781E7169C264EC927DEB7387|ribT]
    description
    [Pubmed|8159171]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8159171], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|FMN-box|FMN-box]: transcription termination, via [SW|FMN-box] in the presence of FMN or FMNH2, this is counter-acted upon binding of [protein|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|RibR], in [regulon|FMN-box|FMN-box]
  • regulation

  • expressed in the absence of FMN ([SW|FMN-box]) [Pubmed|15808508]
  • binding of FMN to the [SW|FMN-box] RNA is facilitated by [protein|43CFA3477B4EEB4CE0B2DF63ED2B5EDB171E79C7|NusG]-mediated transcription pausing [pubmed|32817529]
  • the [SW|FMN-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE23240 ([gene|8146A052E4E7844F781E7169C264EC927DEB7387|ribT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACCCCTCTATATC, downstream forward: _UP4_TAAGCAGAGGCTGTGATCAG
  • BKK23240 ([gene|8146A052E4E7844F781E7169C264EC927DEB7387|ribT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACCCCTCTATATC, downstream forward: _UP4_TAAGCAGAGGCTGTGATCAG
  • References

  • 12456892,15808508,23270261,8159171,7934830,24442413,25349719,26494285,29241954,29805114