SubtiBank SubtiBank
ybyB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ybyB

general stress protein, survival of ethanol stress
locus
BSU_02110
pI
9.22
mw
9.72 kDa
protein length
gene length
261 bp Sequence Blast
function
survival of ethanol stress
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    230,819 231,079

    Expression and Regulation

    Operons

    genes
    [gene|815996BD31BB93863BA8ABF881B7662BDD66EA0F|ybyB]
    description
    [pubmed|16021622]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B974 (ybyB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1973 NBRP B. subtilis, Japan]
  • BKE02110 ([gene|815996BD31BB93863BA8ABF881B7662BDD66EA0F|ybyB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTGATACTCCTTTCTA, downstream forward: _UP4_TAATCAAAAAGCTCTCTTCG
  • BKK02110 ([gene|815996BD31BB93863BA8ABF881B7662BDD66EA0F|ybyB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTGATACTCCTTTCTA, downstream forward: _UP4_TAATCAAAAAGCTCTCTTCG
  • References

  • 15805528