SubtiBank SubtiBank
srfAA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

srfAA

surfactin synthetase / competence
locus
BSU_03480
pI
4.87
mw
401.68 kDa
protein length
3588 aa Sequence Blast
gene length
10764 bp Sequence Blast
function
antibiotic synthesis, biocontrol of fungal growth
product
surfactin synthetase / competence
essential
no
synonyms
comL

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.4|Swarming]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    376,968 → 387,731

    Phenotypes of a mutant

  • altered cell death pattern in colonies [Pubmed|23012477]
  • reduced swarming of srfAA mutant of ''B. subtilis'' NCIB3610 [Pubmed|15066026]
  • The protein

    Protein family

  • [SW|ATP-dependent AMP-binding enzyme family] (according to UniProt)
  • Paralogous protein(s)

  • partial match (more than 1,000 amino acids): [protein|95B75CFF126AF0AD845E62B4036DD3B6DAC8C7FA|DhbF], [protein|13EB6B903088C11D985DDB7CEC864797058FE038|PksJ], [protein|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|PksN], [protein|E3D7EF8F165CAC2682B0D620081C5C6E555E43C4|PpsA], [protein|E7A2F93B33B1899313893D362D92405232BC9097|PpsB], [protein|C1C051209943E02369356075EAA733297E9478CB|PpsE], [protein|1D5F227860A321506A1AB4BAE63CAD3A66E43BFC|SrfAC]
  • [SW|Domains]

  • 3 Carrier domains (aa 971-1046, aa 2010-2085, aa 3038-3112) (according to UniProt)
  • Modification

  • phosphorylation on Ser-1006 [Pubmed|17218307]
  • Structure

  • [PDB|2VSQ] (termination module of [protein|1D5F227860A321506A1AB4BAE63CAD3A66E43BFC|SrfAC], 35% identity) [pubmed|18583577]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|81845F44CE2C601555066E31E87384FF5D7B4139|srfAA]-[gene|3C484FDB3A440269E87D6B6E8500A875AC456666|srfAB]-[gene|4D76F07D6124D56C7CEBBDAB9E84B2718BF1E7FC|comS]-[gene|1D5F227860A321506A1AB4BAE63CAD3A66E43BFC|srfAC]-[gene|9D0914FC38FFF4028C2BA5970DC87B3A1027E253|srfAD]
    description
    [Pubmed|1715856]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1715856], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|25666134], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|8830686], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, [Pubmed|1715856,16091051], in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: activation, [Pubmed|16166527], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: repression, [Pubmed|12642660], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: repression, [Pubmed|20817675], in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • regulation

  • expressed at high cell density ([protein|search|ComA]) [Pubmed|16091051]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|hxlR]' and '[protein|search|srfAA]' [PubMed|20525796]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • BKE03480 (Δ[gene|81845F44CE2C601555066E31E87384FF5D7B4139|srfAA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGTCATACCTCCCCT, downstream forward: _UP4_GAAATTTTCTAATAGAGGTG
  • BKK03480 (Δ[gene|81845F44CE2C601555066E31E87384FF5D7B4139|srfAA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGTCATACCTCCCCT, downstream forward: _UP4_GAAATTTTCTAATAGAGGTG
  • References

    Reviews

  • 20735481
  • Original publications

  • 8288534,8387999,1938922,16166527,17227471,8825779,8830686,18763711,17218307,17190806,1715856,19605685,19826092,12642660,20148996,16091051,20797616,20525796,21821766,23012477,22511326,20817675,15066026,24425772,25448819,25666134,26582911,26953743,26883633,27920766,18583577,30824454