SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


flagellar hook cap, required for hook assembly
15.50 kDa
protein length
140 aa Sequence Blast
gene length
423 bp Sequence Blast
flagellar hook assembly
flagellar hook cap

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • Gene

    1,699,738 1,700,160

    Phenotypes of a mutant

  • lack of [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]-dependent gene expression (no ''[gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]'' expression), no motility [Pubmed|22730131]
  • inactivation of ''[gene|819FAE47ADC9A4FE55C8F2105E19FA7EE286FC0C|flgD]'' confers resistance to high concentrations of Zn(II) [Pubmed|27935957]
  • The protein

    Catalyzed reaction/ biological activity

  • flagellar hook assembly [Pubmed|22730131]
  • assists incorporation of a [protein|DC906ED8D787602B5796BAD8FD81F02C4BAC8D13|FlgE] monomer into the nascent hook structure [Pubmed|26490009]
  • Protein family

  • FlgD family (single member, according to UniProt)
  • [SW|Localization]

  • flagellum hook (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|20233303], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: regulation, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • regulation

  • see [SW|fla-che operon]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9657996], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • MGNA-B104 (ylxG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE16280 ([gene|819FAE47ADC9A4FE55C8F2105E19FA7EE286FC0C|flgD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTCATTCTTCTTCCTCCAT, downstream forward: _UP4_TAAAAACATCTGGGGGAATA
  • BKK16280 ([gene|819FAE47ADC9A4FE55C8F2105E19FA7EE286FC0C|flgD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTCATTCTTCTTCCTCCAT, downstream forward: _UP4_TAAAAACATCTGGGGGAATA
  • References


  • 26490009
  • Original publications

  • 14651647,9657996,8157612,15175317,17850253,22730131,24386445,27935957