SubtiBank SubtiBank
xkdH
The papers of the month are back! Check them out! Link here

xkdH

PBSX prophage
locus
BSU12620
pI
6.04
mw
13.84 kDa
protein length
118 aa Sequence Blast
gene length
354 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • Gene

    Coordinates
    1,330,892 → 1,331,248

    The protein

    Structure

  • [PDB|3F3B]
  • Expression and Regulation

    Operons

    genes
    [gene|DD4F52FE386EF75009ECF594ED4E2D1593220E4F|xtmA]-[gene|277F51EB4FE2BAB0FD1808EDE25705E10833AD0A|xtmB]-[gene|E77DD93E3CDCA9B81106E6AB0F18513360AAE9DB|xkdE]-[gene|6542BE447872C1A16C056DA21BD7A23C65F5C543|xkdF]-[gene|38173C76C27A7178CEE66E3642533EB34828C2CB|xkdG]-[gene|81C6812565B3E8ADCB19F52BDFFA9E55B94A2E9D|xkdH]-[gene|5ACCC439AD8849355094F8C5FC6EF29A9077EF58|xkdI]-[gene|6DF19E4546509687CA194F6B44EEB723C9467B9C|xkdJ]-[gene|31B1832E5EAD957EE6A5C7CB0C117EC0F26AA8AB|xkdK]-[gene|683D350D98AC0D27951145AD87830B89C0B4F393|xkdM]
    description
    [Pubmed|2110147]

    sigma factors

  • [protein|458406A4E6824C24493CFC19718F10720AA3B453|Xpf]: sigma factor, [Pubmed|8083174], in [regulon|458406A4E6824C24493CFC19718F10720AA3B453|Xpf regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • BKE12620 (Δ[gene|81C6812565B3E8ADCB19F52BDFFA9E55B94A2E9D|xkdH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTGAATGAGCATCTGCCTGT, downstream forward: _UP4_GTCGCAGTCAGGGATGAAAG
  • BKK12620 (Δ[gene|81C6812565B3E8ADCB19F52BDFFA9E55B94A2E9D|xkdH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTGAATGAGCATCTGCCTGT, downstream forward: _UP4_GTCGCAGTCAGGGATGAAAG
  • References

  • 2110147,8083174