SubtiBank SubtiBank
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.


PBSX prophage
13.84 kDa
protein length
118 aa Sequence Blast
gene length
354 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • Gene

    1,330,892 → 1,331,248

    The protein


  • [PDB|3F3B]
  • Expression and Regulation



    sigma factors

  • [protein|458406A4E6824C24493CFC19718F10720AA3B453|Xpf]: sigma factor, [Pubmed|8083174], in [regulon|458406A4E6824C24493CFC19718F10720AA3B453|Xpf regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • BKE12620 (Δ[gene|81C6812565B3E8ADCB19F52BDFFA9E55B94A2E9D|xkdH]::erm trpC2), available at [ BGSC], upstream reverse: _UP1_GTGAATGAGCATCTGCCTGT, downstream forward: _UP4_GTCGCAGTCAGGGATGAAAG
  • BKK12620 (Δ[gene|81C6812565B3E8ADCB19F52BDFFA9E55B94A2E9D|xkdH]::kan trpC2), available at [ BGSC], upstream reverse: _UP1_GTGAATGAGCATCTGCCTGT, downstream forward: _UP4_GTCGCAGTCAGGGATGAAAG
  • References

  • 2110147,8083174