SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


deoxyribose-phosphate aldolase
22.06 kDa
protein length
223 aa Sequence Blast
gene length
672 bp Sequence Blast
utilization of nucleotides as carbon source
deoxyribose-phosphate aldolase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    4,051,602 4,052,273

    The protein

    Catalyzed reaction/ biological activity

  • 2-deoxy-D-ribose 5-phosphate --> acetaldehyde + D-glyceraldehyde 3-phosphate (according to UniProt)
  • Protein family

  • DeoC/FbaB aldolase family (single member, according to UniProt)
  • Structure

  • [PDB|1MZH] (from ''Aquifex aeolicus'', 42% identity, 62% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8550462], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E9C4C569F18B3335DA9C7FB5B17C87D661E62669|DeoR]: repression, [Pubmed|8550462], in [regulon|E9C4C569F18B3335DA9C7FB5B17C87D661E62669|DeoR regulon]
  • regulation

  • induced by deoxynucleotides ([protein|search|DeoR]) [Pubmed|8550462]
  • view in new tab

    Biological materials


  • BKE39420 ([gene|81CD1F97E887549F7FB742FCEF38B86B84383F5D|dra]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTTCGCACACTTCCTT, downstream forward: _UP4_TAAGAGCTGACGGAAGGCAG
  • BKK39420 ([gene|81CD1F97E887549F7FB742FCEF38B86B84383F5D|dra]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTTCGCACACTTCCTT, downstream forward: _UP4_TAAGAGCTGACGGAAGGCAG
  • References

  • 10666464,11065368,8550462,10074062