SubtiBank SubtiBank
dra
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

dra

deoxyribose-phosphate aldolase
locus
BSU_39420
pI
4.93
mw
22.06 kDa
protein length
223 aa Sequence Blast
gene length
672 bp Sequence Blast
function
utilization of nucleotides as carbon source
product
deoxyribose-phosphate aldolase
essential
no
ec
4.1.2.4
synonyms
deoC

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    Coordinates
    4,051,602 4,052,273

    The protein

    Catalyzed reaction/ biological activity

  • 2-deoxy-D-ribose 5-phosphate --> acetaldehyde + D-glyceraldehyde 3-phosphate (according to UniProt)
  • Protein family

  • DeoC/FbaB aldolase family (single member, according to UniProt)
  • Structure

  • [PDB|1MZH] (from ''Aquifex aeolicus'', 42% identity, 62% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|81CD1F97E887549F7FB742FCEF38B86B84383F5D|dra]-[gene|4F718681A7AD0C86B2551248570F493AC0B2E7E9|nupC]-[gene|D2EB7BBAC8817912DAC4E215879F5A4E2C47ECAF|pdp]
    description
    [Pubmed|8550462]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8550462], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E9C4C569F18B3335DA9C7FB5B17C87D661E62669|DeoR]: repression, [Pubmed|8550462], in [regulon|E9C4C569F18B3335DA9C7FB5B17C87D661E62669|DeoR regulon]
  • regulation

  • induced by deoxynucleotides ([protein|search|DeoR]) [Pubmed|8550462]
  • view in new tab

    Biological materials

    Mutant

  • BKE39420 ([gene|81CD1F97E887549F7FB742FCEF38B86B84383F5D|dra]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTTCGCACACTTCCTT, downstream forward: _UP4_TAAGAGCTGACGGAAGGCAG
  • BKK39420 ([gene|81CD1F97E887549F7FB742FCEF38B86B84383F5D|dra]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTTCGCACACTTCCTT, downstream forward: _UP4_TAAGAGCTGACGGAAGGCAG
  • References

  • 10666464,11065368,8550462,10074062