SubtiBank SubtiBank
sdpC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sdpC

toxin, collapses the proton motive force and induces autolysis, kills non-sporulating cells, induces activity of [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]
locus
BSU_33770
pI
9.61
mw
22.07 kDa
protein length
203 aa Sequence Blast
gene length
612 bp Sequence Blast
function
killing of non-sporulating sister cells
product
toxin, kills non-sporulating cells
essential
no
synonyms
yvaY

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.3|Toxins, antitoxins and immunity/ Additional genes]
  • Gene

    Coordinates
    3,465,776 3,466,387

    The protein

    Catalyzed reaction/ biological activity

  • toxin, collapses the proton motive force and induces autolysis [Pubmed|22469514]
  • Paralogous protein(s)

  • [protein|330CB6A25181F7AFD3C63F73CA21A3428882D100|YitM]
  • Modification

  • the mature SDP is a 42-residue peptide with one disulfide bridge [Pubmed|20805502]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|219092C574A13B81CD312AEB55BAE48A3C541FB7|sdpA]-[gene|073D63E17C8248BE39F331FDE9902E21A34056D5|sdpB]-[gene|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC]
    description
    [Pubmed|12817086]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [PubMed|14651647,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|15687200,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [http://www.ncbi.nlm.nih.gov/sites/entrez/14651647,15687200 PubMed]
  • additional information

  • the amount of the mRNA is substantially decreased upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A452 (yvaY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/452 NBRP B. subtilis, Japan]
  • BKE33770 ([gene|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTATTATACCTCCATT, downstream forward: _UP4_TAATCCATTATAATTGAGTG
  • BKK33770 ([gene|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTATTATACCTCCATT, downstream forward: _UP4_TAATCCATTATAATTGAGTG
  • References

    Reviews

  • 20955377
  • Original Publications

  • 12817086,16469701,16629676,13129613,14651647,15687200,15743949,15687200,17720793,12107147,22469514,20805502,23687264,21815947