SubtiBank SubtiBank
sdpC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

sdpC

toxin, collapses the proton motive force and induces autolysis, kills non-sporulating cells, induces activity of [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]
locus
BSU_33770
pI
9.61
mw
22.07 kDa
protein length
203 aa Sequence Blast
gene length
612 bp Sequence Blast
function
killing of non-sporulating sister cells
product
toxin, kills non-sporulating cells
essential
no
synonyms
yvaY

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.3|Toxins, antitoxins and immunity/ Additional genes]
  • Gene

    Coordinates
    3,465,776 3,466,387

    The protein

    Catalyzed reaction/ biological activity

  • toxin, collapses the proton motive force and induces autolysis [Pubmed|22469514]
  • Paralogous protein(s)

  • [protein|330CB6A25181F7AFD3C63F73CA21A3428882D100|YitM]
  • Modification

  • the mature SDP is a 42-residue peptide with one disulfide bridge [Pubmed|20805502]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|219092C574A13B81CD312AEB55BAE48A3C541FB7|sdpA]-[gene|073D63E17C8248BE39F331FDE9902E21A34056D5|sdpB]-[gene|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC]
    description
    [Pubmed|12817086]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [PubMed|14651647,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|15687200,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [http://www.ncbi.nlm.nih.gov/sites/entrez/14651647,15687200 PubMed]
  • additional information

  • the amount of the mRNA is substantially decreased upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A452 (yvaY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/452 NBRP B. subtilis, Japan]
  • BKE33770 ([gene|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTATTATACCTCCATT, downstream forward: _UP4_TAATCCATTATAATTGAGTG
  • BKK33770 ([gene|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTATTATACCTCCATT, downstream forward: _UP4_TAATCCATTATAATTGAGTG
  • References

    Reviews

  • 20955377
  • Original Publications

  • 12817086,16469701,16629676,13129613,14651647,15687200,15743949,15687200,17720793,12107147,22469514,20805502,23687264,21815947