SubtiBank SubtiBank
yuzF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yuzF

unknown
locus
BSU_31820
pI
9.60
mw
8.73 kDa
protein length
gene length
237 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    3,264,265 3,264,501

    Expression and Regulation

    Operons

    genes
    [gene|8242948F9F7F7B0193C82AC2311141FF63038FF6|yuzF]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A646 (yuzF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/646 NBRP B. subtilis, Japan]
  • BKE31820 ([gene|8242948F9F7F7B0193C82AC2311141FF63038FF6|yuzF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTTTTATCCCCTTTGT, downstream forward: _UP4_TAACAGTGCTTGCGCATGAA
  • BKK31820 ([gene|8242948F9F7F7B0193C82AC2311141FF63038FF6|yuzF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTTTTATCCCCTTTGT, downstream forward: _UP4_TAACAGTGCTTGCGCATGAA