SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


aminosugar [SW|ABC transporter] (permease)
32.68 kDa
protein length
292 aa Sequence Blast
gene length
879 bp Sequence Blast
uptake of sugar amines
aminosugar [SW|ABC transporter] (permease)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of amino sugars]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of amino sugars]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,348,825 3,349,703

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|MalFG subfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|ABC transmembrane type-1 domain] (aa 66-282) (according to UniProt)
  • Structure

  • [PDB|4TQU] (from Sphingomonas sp., 28% identity) [pubmed|26235029]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [pubmed|12618455], [pubmed|18083814], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|412A1DBBE7F87765DEBEEAAE02A047636A354D5E|FrlR]: repression, [Pubmed|21398478], in [regulon|412A1DBBE7F87765DEBEEAAE02A047636A354D5E|FrlR regulon]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • '' [protein|C87E74FB67B53DD1C68916AA121388C60CE66E92|FrlB]'': repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]) [Pubmed|12618455]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • additional information

  • the [gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]-[gene|9E3FF9D0B33D7EFEA3B61FF863BB46CC6DFD4F9B|frlO]-[gene|8256CAAEC591E40A8CB172FF053E03BFFD5A4B54|frlN]-[gene|1F245030D0C81DC96FC0642199CA00579CF46D06|frlM]-[gene|C3823AFED3E5C3D1EA04C38D861239468C9E6349|frlD]-[gene|3B9331D6755B8253944AB33521BBF2B3EBA4CAEB|yurJ] operon is strongly downregulated in a [gene|search|cshA ]mutant [Pubmed|23175651]
  • view in new tab

    Biological materials


  • MGNA-A560 (yurN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32590 ([gene|8256CAAEC591E40A8CB172FF053E03BFFD5A4B54|frlN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGGTATCTCATCTCCTT, downstream forward: _UP4_AAAACCGGAAAGGAGGAGTA
  • BKK32590 ([gene|8256CAAEC591E40A8CB172FF053E03BFFD5A4B54|frlN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGGTATCTCATCTCCTT, downstream forward: _UP4_AAAACCGGAAAGGAGGAGTA
  • References

  • 23175651,21815947,12618455,10092453,21347729,21398478,26235029